Incidental Mutation 'R6613:Ssc5d'
ID 523768
Institutional Source Beutler Lab
Gene Symbol Ssc5d
Ensembl Gene ENSMUSG00000035279
Gene Name scavenger receptor cysteine rich family, 5 domains
Synonyms s5d-srcrb, A430110N23Rik
MMRRC Submission 044736-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6613 (G1)
Quality Score 159.009
Status Validated
Chromosome 7
Chromosomal Location 4925785-4944826 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4933293 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 513 (P513S)
Ref Sequence ENSEMBL: ENSMUSP00000052126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057612]
AlphaFold Q8BV57
Predicted Effect possibly damaging
Transcript: ENSMUST00000057612
AA Change: P513S

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: P513S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207310
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 G A 6: 125,806,656 probably null Het
Arfgef1 A T 1: 10,194,396 I475N possibly damaging Het
Atg16l2 C T 7: 101,290,581 probably null Het
Atp2c2 T G 8: 119,756,021 L874R probably damaging Het
C2cd3 T A 7: 100,395,241 S343R possibly damaging Het
C4b A T 17: 34,733,565 S1167T probably damaging Het
Cacna1i G A 15: 80,321,259 G139S probably damaging Het
Chil6 A T 3: 106,389,875 F317I probably benign Het
Cngb1 A T 8: 95,266,010 V199E possibly damaging Het
Dcn A T 10: 97,495,040 T79S probably benign Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Dnajc13 A T 9: 104,213,877 D668E probably benign Het
Dnajc28 C A 16: 91,616,358 E357* probably null Het
Dock7 A G 4: 98,977,960 Y1198H probably damaging Het
Flot1 A G 17: 35,825,811 D167G probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Hyou1 A T 9: 44,382,498 I242F probably damaging Het
Igfbpl1 T C 4: 45,813,447 N256S probably benign Het
Kif20b C T 19: 34,936,984 Q390* probably null Het
Lhfpl2 T A 13: 94,174,495 F91Y probably damaging Het
Magi1 G A 6: 93,745,673 T408I probably damaging Het
Mttp T C 3: 138,109,078 N479D probably damaging Het
Myom3 T C 4: 135,812,459 V1339A possibly damaging Het
Nin T C 12: 70,030,954 K1733E probably damaging Het
Olfr173 C A 16: 58,797,531 C105F probably damaging Het
Pdzrn4 T C 15: 92,677,574 I287T probably damaging Het
Ptprt A G 2: 161,530,447 V1435A probably damaging Het
Rpap3 T C 15: 97,681,841 probably null Het
Scin A G 12: 40,079,715 Y360H probably benign Het
Sfxn5 A G 6: 85,269,908 probably null Het
Sgo1 A G 17: 53,679,057 S369P probably damaging Het
Skil T A 3: 31,097,880 C184S probably null Het
Srcin1 A G 11: 97,533,827 M607T possibly damaging Het
Trip10 A G 17: 57,255,197 probably null Het
Vmn2r114 T A 17: 23,310,246 Q294L possibly damaging Het
Zc3h12c A G 9: 52,116,112 V650A possibly damaging Het
Other mutations in Ssc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ssc5d APN 7 4944481 missense possibly damaging 0.63
IGL00939:Ssc5d APN 7 4936281 missense possibly damaging 0.89
IGL01109:Ssc5d APN 7 4937112 nonsense probably null
IGL01409:Ssc5d APN 7 4942809 missense probably benign 0.16
IGL01880:Ssc5d APN 7 4933219 missense probably damaging 1.00
IGL02013:Ssc5d APN 7 4943836 missense probably benign 0.00
IGL02227:Ssc5d APN 7 4933454 critical splice donor site probably null
IGL02963:Ssc5d APN 7 4944327 missense probably benign 0.02
D4043:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
D4216:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
R0104:Ssc5d UTSW 7 4936286 missense probably benign 0.41
R0115:Ssc5d UTSW 7 4927881 unclassified probably benign
R0201:Ssc5d UTSW 7 4944663 missense probably benign
R0365:Ssc5d UTSW 7 4928467 nonsense probably null
R0485:Ssc5d UTSW 7 4937471 missense probably damaging 0.99
R0967:Ssc5d UTSW 7 4944343 nonsense probably null
R1607:Ssc5d UTSW 7 4944043 missense probably benign 0.25
R1639:Ssc5d UTSW 7 4928417 missense probably damaging 1.00
R1801:Ssc5d UTSW 7 4936607 missense probably benign 0.05
R1867:Ssc5d UTSW 7 4928507 missense probably damaging 1.00
R1999:Ssc5d UTSW 7 4942714 missense possibly damaging 0.86
R2007:Ssc5d UTSW 7 4928629 missense probably damaging 1.00
R2084:Ssc5d UTSW 7 4937012 missense probably benign 0.01
R2234:Ssc5d UTSW 7 4943850 missense probably benign
R2259:Ssc5d UTSW 7 4943916 missense probably benign 0.01
R2567:Ssc5d UTSW 7 4936335 missense probably damaging 1.00
R2879:Ssc5d UTSW 7 4936907 critical splice acceptor site probably null
R3782:Ssc5d UTSW 7 4942791 missense probably benign 0.00
R3875:Ssc5d UTSW 7 4927262 missense probably damaging 1.00
R4322:Ssc5d UTSW 7 4928450 missense probably damaging 1.00
R4331:Ssc5d UTSW 7 4942726 missense probably benign 0.00
R4334:Ssc5d UTSW 7 4943664 missense probably benign
R4430:Ssc5d UTSW 7 4943664 missense probably benign
R4619:Ssc5d UTSW 7 4929525 missense probably damaging 1.00
R4794:Ssc5d UTSW 7 4943745 missense probably benign
R5106:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R5174:Ssc5d UTSW 7 4927971 missense possibly damaging 0.83
R5553:Ssc5d UTSW 7 4936290 missense probably damaging 1.00
R5649:Ssc5d UTSW 7 4926518 critical splice donor site probably null
R5786:Ssc5d UTSW 7 4936818 missense probably benign 0.00
R6059:Ssc5d UTSW 7 4942744 missense possibly damaging 0.86
R6163:Ssc5d UTSW 7 4927254 missense probably damaging 1.00
R6332:Ssc5d UTSW 7 4937522 missense probably damaging 1.00
R6341:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R7180:Ssc5d UTSW 7 4936601 missense probably benign 0.17
R7576:Ssc5d UTSW 7 4928573 missense probably damaging 1.00
R7602:Ssc5d UTSW 7 4942746 missense possibly damaging 0.95
R7609:Ssc5d UTSW 7 4927576 missense possibly damaging 0.56
R7691:Ssc5d UTSW 7 4944169 missense probably benign 0.29
R7759:Ssc5d UTSW 7 4937530 nonsense probably null
R8480:Ssc5d UTSW 7 4936329 missense probably damaging 1.00
R9029:Ssc5d UTSW 7 4927920 missense probably damaging 0.97
R9163:Ssc5d UTSW 7 4933433 missense probably damaging 1.00
R9178:Ssc5d UTSW 7 4927059 missense probably damaging 1.00
R9181:Ssc5d UTSW 7 4942815 missense possibly damaging 0.86
R9382:Ssc5d UTSW 7 4927284 critical splice donor site probably null
R9489:Ssc5d UTSW 7 4937600 missense probably benign 0.02
R9626:Ssc5d UTSW 7 4943569 missense probably benign
R9630:Ssc5d UTSW 7 4936427 missense probably damaging 1.00
R9776:Ssc5d UTSW 7 4929368 missense probably benign 0.07
X0063:Ssc5d UTSW 7 4936287 missense probably damaging 1.00
Z1088:Ssc5d UTSW 7 4928434 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGAAGGCTCAGAGTGCTAGC -3'
(R):5'- TCCTCACCAGTGCAGGTAAC -3'

Sequencing Primer
(F):5'- GCTAGCTGGGCTCTTTGACC -3'
(R):5'- GGTAACCCCGACATCCTCATTG -3'
Posted On 2018-06-22