Incidental Mutation 'R6613:C2cd3'
ID523770
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6613 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100395241 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 343 (S343R)
Ref Sequence ENSEMBL: ENSMUSP00000095859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051777
AA Change: S343R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: S343R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098259
AA Change: S343R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: S343R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119647
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133464
SMART Domains Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208753
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 G A 6: 125,806,656 probably null Het
Arfgef1 A T 1: 10,194,396 I475N possibly damaging Het
Atg16l2 C T 7: 101,290,581 probably null Het
Atp2c2 T G 8: 119,756,021 L874R probably damaging Het
C4b A T 17: 34,733,565 S1167T probably damaging Het
Cacna1i G A 15: 80,321,259 G139S probably damaging Het
Chil6 A T 3: 106,389,875 F317I probably benign Het
Cngb1 A T 8: 95,266,010 V199E possibly damaging Het
Dcn A T 10: 97,495,040 T79S probably benign Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Dnajc13 A T 9: 104,213,877 D668E probably benign Het
Dnajc28 C A 16: 91,616,358 E357* probably null Het
Dock7 A G 4: 98,977,960 Y1198H probably damaging Het
Flot1 A G 17: 35,825,811 D167G probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Hyou1 A T 9: 44,382,498 I242F probably damaging Het
Igfbpl1 T C 4: 45,813,447 N256S probably benign Het
Kif20b C T 19: 34,936,984 Q390* probably null Het
Lhfpl2 T A 13: 94,174,495 F91Y probably damaging Het
Magi1 G A 6: 93,745,673 T408I probably damaging Het
Mttp T C 3: 138,109,078 N479D probably damaging Het
Myom3 T C 4: 135,812,459 V1339A possibly damaging Het
Nin T C 12: 70,030,954 K1733E probably damaging Het
Olfr173 C A 16: 58,797,531 C105F probably damaging Het
Pdzrn4 T C 15: 92,677,574 I287T probably damaging Het
Ptprt A G 2: 161,530,447 V1435A probably damaging Het
Rpap3 T C 15: 97,681,841 probably null Het
Scin A G 12: 40,079,715 Y360H probably benign Het
Sfxn5 A G 6: 85,269,908 probably null Het
Sgo1 A G 17: 53,679,057 S369P probably damaging Het
Skil T A 3: 31,097,880 C184S probably null Het
Srcin1 A G 11: 97,533,827 M607T possibly damaging Het
Ssc5d C T 7: 4,933,293 P513S possibly damaging Het
Trip10 A G 17: 57,255,197 probably null Het
Vmn2r114 T A 17: 23,310,246 Q294L possibly damaging Het
Zc3h12c A G 9: 52,116,112 V650A possibly damaging Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
R7335:C2cd3 UTSW 7 100422603 missense
R7357:C2cd3 UTSW 7 100430103 missense
R7493:C2cd3 UTSW 7 100427226 missense
R7567:C2cd3 UTSW 7 100430815 missense
R7573:C2cd3 UTSW 7 100419707 missense
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCAAGGAATTGCCAGACTAATGG -3'
(R):5'- ACTGTAGGCTCAGCACACTAAG -3'

Sequencing Primer
(F):5'- CAGATGCAGAGGCCACTG -3'
(R):5'- GCACACTAAGAATTATTTGCTGACGG -3'
Posted On2018-06-22