Mutagenetix > Incidental Mutation

Incidental Mutation 'R6613:C2cd3'

523770

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

044736-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6613 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100021440-100119359 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100044448 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 343 (S343R)

Ref Sequence

ENSEMBL: ENSMUSP00000095859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]

AlphaFold

Q52KB6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051777
AA Change: S343R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: S343R

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098259
AA Change: S343R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: S343R

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119647

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133464

SMART Domains

Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156559

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208753

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.9%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano2	G	A	6: 125,783,619 (GRCm39)		probably null	Het
Arfgef1	A	T	1: 10,264,621 (GRCm39)	I475N	possibly damaging	Het
Atg16l2	C	T	7: 100,939,788 (GRCm39)		probably null	Het
Atp2c2	T	G	8: 120,482,760 (GRCm39)	L874R	probably damaging	Het
C4b	A	T	17: 34,952,539 (GRCm39)	S1167T	probably damaging	Het
Cacna1i	G	A	15: 80,205,460 (GRCm39)	G139S	probably damaging	Het
Chil6	A	T	3: 106,297,191 (GRCm39)	F317I	probably benign	Het
Cngb1	A	T	8: 95,992,638 (GRCm39)	V199E	possibly damaging	Het
Dcn	A	T	10: 97,330,902 (GRCm39)	T79S	probably benign	Het
Dcxr	A	G	11: 120,617,832 (GRCm39)	V48A	probably benign	Het
Dnajc13	A	T	9: 104,091,076 (GRCm39)	D668E	probably benign	Het
Dnajc28	C	A	16: 91,413,246 (GRCm39)	E357*	probably null	Het
Dock7	A	G	4: 98,866,197 (GRCm39)	Y1198H	probably damaging	Het
Flot1	A	G	17: 36,136,703 (GRCm39)	D167G	probably damaging	Het
Gpn1	T	C	5: 31,654,696 (GRCm39)		probably null	Het
Hyou1	A	T	9: 44,293,795 (GRCm39)	I242F	probably damaging	Het
Igfbpl1	T	C	4: 45,813,447 (GRCm39)	N256S	probably benign	Het
Kif20b	C	T	19: 34,914,384 (GRCm39)	Q390*	probably null	Het
Lhfpl2	T	A	13: 94,311,003 (GRCm39)	F91Y	probably damaging	Het
Magi1	G	A	6: 93,722,654 (GRCm39)	T408I	probably damaging	Het
Mttp	T	C	3: 137,814,839 (GRCm39)	N479D	probably damaging	Het
Myom3	T	C	4: 135,539,770 (GRCm39)	V1339A	possibly damaging	Het
Nin	T	C	12: 70,077,728 (GRCm39)	K1733E	probably damaging	Het
Or5k1	C	A	16: 58,617,894 (GRCm39)	C105F	probably damaging	Het
Pdzrn4	T	C	15: 92,575,455 (GRCm39)	I287T	probably damaging	Het
Ptprt	A	G	2: 161,372,367 (GRCm39)	V1435A	probably damaging	Het
Rpap3	T	C	15: 97,579,722 (GRCm39)		probably null	Het
Scin	A	G	12: 40,129,714 (GRCm39)	Y360H	probably benign	Het
Sfxn5	A	G	6: 85,246,890 (GRCm39)		probably null	Het
Sgo1	A	G	17: 53,986,085 (GRCm39)	S369P	probably damaging	Het
Skil	T	A	3: 31,152,029 (GRCm39)	C184S	probably null	Het
Srcin1	A	G	11: 97,424,653 (GRCm39)	M607T	possibly damaging	Het
Ssc5d	C	T	7: 4,936,292 (GRCm39)	P513S	possibly damaging	Het
Trip10	A	G	17: 57,562,197 (GRCm39)		probably null	Het
Vmn2r114	T	A	17: 23,529,220 (GRCm39)	Q294L	possibly damaging	Het
Zc3h12c	A	G	9: 52,027,412 (GRCm39)	V650A	possibly damaging	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100,040,335 (GRCm39)	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100,104,065 (GRCm39)	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100,092,638 (GRCm39)	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100,076,421 (GRCm39)	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100,023,693 (GRCm39)	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100,068,922 (GRCm39)	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100,076,376 (GRCm39)	unclassified	probably benign
IGL02852:C2cd3	APN	7	100,079,396 (GRCm39)	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100,023,683 (GRCm39)	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100,067,729 (GRCm39)	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100,067,729 (GRCm39)	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100,065,269 (GRCm39)	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100,065,269 (GRCm39)	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100,093,652 (GRCm39)	unclassified	probably benign
R0032:C2cd3	UTSW	7	100,093,652 (GRCm39)	unclassified	probably benign
R0124:C2cd3	UTSW	7	100,118,725 (GRCm39)	missense	probably benign
R0387:C2cd3	UTSW	7	100,071,714 (GRCm39)	splice site	probably benign
R0522:C2cd3	UTSW	7	100,044,429 (GRCm39)	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100,071,888 (GRCm39)	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100,089,397 (GRCm39)	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100,055,284 (GRCm39)	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100,021,704 (GRCm39)	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100,056,232 (GRCm39)	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100,104,700 (GRCm39)	unclassified	probably benign
R2060:C2cd3	UTSW	7	100,104,155 (GRCm39)	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100,062,573 (GRCm39)	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100,044,459 (GRCm39)	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100,039,373 (GRCm39)	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100,085,040 (GRCm39)	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100,081,205 (GRCm39)	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100,103,808 (GRCm39)	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100,090,296 (GRCm39)	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100,081,306 (GRCm39)	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100,023,684 (GRCm39)	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100,021,657 (GRCm39)	unclassified	probably benign
R4705:C2cd3	UTSW	7	100,044,395 (GRCm39)	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100,092,642 (GRCm39)	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100,065,539 (GRCm39)	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100,040,226 (GRCm39)	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100,065,397 (GRCm39)	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100,104,160 (GRCm39)	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100,062,581 (GRCm39)	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100,055,166 (GRCm39)	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100,109,049 (GRCm39)	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100,092,692 (GRCm39)	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100,039,373 (GRCm39)	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100,104,700 (GRCm39)	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100,093,682 (GRCm39)	unclassified	probably benign
R6110:C2cd3	UTSW	7	100,090,283 (GRCm39)	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100,065,635 (GRCm39)	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100,081,298 (GRCm39)	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100,104,505 (GRCm39)	missense	probably benign
R6631:C2cd3	UTSW	7	100,067,747 (GRCm39)	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100,104,553 (GRCm39)	missense	probably benign
R6837:C2cd3	UTSW	7	100,097,953 (GRCm39)	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100,056,134 (GRCm39)	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100,039,448 (GRCm39)	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100,100,826 (GRCm39)	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100,081,299 (GRCm39)	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100,065,388 (GRCm39)	missense
R7174:C2cd3	UTSW	7	100,081,405 (GRCm39)	missense
R7241:C2cd3	UTSW	7	100,056,257 (GRCm39)	missense
R7335:C2cd3	UTSW	7	100,071,810 (GRCm39)	missense
R7357:C2cd3	UTSW	7	100,079,310 (GRCm39)	missense
R7493:C2cd3	UTSW	7	100,076,433 (GRCm39)	missense
R7567:C2cd3	UTSW	7	100,080,022 (GRCm39)	missense
R7573:C2cd3	UTSW	7	100,068,914 (GRCm39)	missense
R7869:C2cd3	UTSW	7	100,118,698 (GRCm39)	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100,109,096 (GRCm39)	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100,067,711 (GRCm39)	missense
R8369:C2cd3	UTSW	7	100,044,465 (GRCm39)	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100,104,487 (GRCm39)	nonsense	probably null
R8753:C2cd3	UTSW	7	100,049,024 (GRCm39)	critical splice donor site	probably null
R8893:C2cd3	UTSW	7	100,104,004 (GRCm39)	missense	probably benign
R8905:C2cd3	UTSW	7	100,074,132 (GRCm39)	critical splice donor site	probably null
R8945:C2cd3	UTSW	7	100,040,286 (GRCm39)	missense	possibly damaging	0.88
R8970:C2cd3	UTSW	7	100,068,971 (GRCm39)	missense
R9000:C2cd3	UTSW	7	100,065,281 (GRCm39)	missense
R9064:C2cd3	UTSW	7	100,059,608 (GRCm39)	missense
R9072:C2cd3	UTSW	7	100,040,291 (GRCm39)	missense	probably benign	0.07
R9126:C2cd3	UTSW	7	100,081,430 (GRCm39)	missense
R9160:C2cd3	UTSW	7	100,075,236 (GRCm39)	missense
R9234:C2cd3	UTSW	7	100,049,012 (GRCm39)	missense
R9258:C2cd3	UTSW	7	100,098,026 (GRCm39)	missense
R9295:C2cd3	UTSW	7	100,081,734 (GRCm39)	missense
R9411:C2cd3	UTSW	7	100,065,704 (GRCm39)	missense
R9420:C2cd3	UTSW	7	100,065,262 (GRCm39)	missense
R9589:C2cd3	UTSW	7	100,081,756 (GRCm39)	missense
R9628:C2cd3	UTSW	7	100,097,961 (GRCm39)	missense
R9629:C2cd3	UTSW	7	100,029,249 (GRCm39)	missense	probably damaging	1.00
R9681:C2cd3	UTSW	7	100,023,662 (GRCm39)	missense	probably benign	0.32
R9775:C2cd3	UTSW	7	100,076,458 (GRCm39)	missense
X0002:C2cd3	UTSW	7	100,089,442 (GRCm39)	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TCAAGGAATTGCCAGACTAATGG -3'
(R):5'- ACTGTAGGCTCAGCACACTAAG -3'

Sequencing Primer
(F):5'- CAGATGCAGAGGCCACTG -3'
(R):5'- GCACACTAAGAATTATTTGCTGACGG -3'

Posted On

2018-06-22