Incidental Mutation 'R6505:Alox12'
ID 523773
Institutional Source Beutler Lab
Gene Symbol Alox12
Ensembl Gene ENSMUSG00000000320
Gene Name arachidonate 12-lipoxygenase
Synonyms 9930022G08Rik, P-12LO, Alox12p
MMRRC Submission 044637-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R6505 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 70132283-70146179 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70141030 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 335 (D335V)
Ref Sequence ENSEMBL: ENSMUSP00000104214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000329] [ENSMUST00000108574]
AlphaFold P39655
Predicted Effect probably damaging
Transcript: ENSMUST00000000329
AA Change: D335V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000329
Gene: ENSMUSG00000000320
AA Change: D335V

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 172 650 5.1e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108574
AA Change: D335V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104214
Gene: ENSMUSG00000000320
AA Change: D335V

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 121 211 8.1e-9 PFAM
Pfam:Lipoxygenase 210 390 3e-61 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased basal transepidermal water loss and hypersensitivity to adenosine 5'-diphosphate-induced platelet aggregation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,220,772 (GRCm39) I424L probably benign Het
2610028H24Rik C T 10: 76,285,115 (GRCm39) A8V probably benign Het
Ago1 G A 4: 126,357,628 (GRCm39) P16S probably benign Het
Ak5 C T 3: 152,187,306 (GRCm39) E394K probably benign Het
Aldh7a1 T C 18: 56,660,068 (GRCm39) Y498C probably damaging Het
Alx4 A T 2: 93,498,904 (GRCm39) Y212F probably damaging Het
Asb16 A G 11: 102,167,303 (GRCm39) E223G probably damaging Het
Atg9b C T 5: 24,595,575 (GRCm39) V235M probably damaging Het
BB014433 A G 8: 15,092,304 (GRCm39) V183A probably benign Het
Brca1 T A 11: 101,414,367 (GRCm39) M1256L probably benign Het
Bst1 A G 5: 43,977,932 (GRCm39) I94V probably benign Het
C3ar1 A G 6: 122,827,599 (GRCm39) L206P probably benign Het
Cabs1 T A 5: 88,128,522 (GRCm39) M391K possibly damaging Het
Cars1 C T 7: 143,118,744 (GRCm39) R599Q probably damaging Het
Ccdc190 T A 1: 169,760,592 (GRCm39) Y73* probably null Het
Cd177 A C 7: 24,443,671 (GRCm39) L809W probably benign Het
Cemip C A 7: 83,600,805 (GRCm39) G939* probably null Het
Clca3b T A 3: 144,531,020 (GRCm39) I777F probably benign Het
Cma2 T C 14: 56,211,236 (GRCm39) I176T probably damaging Het
Col12a1 T A 9: 79,554,887 (GRCm39) T2064S probably damaging Het
Csf1r A G 18: 61,262,805 (GRCm39) N860S probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dennd4b A G 3: 90,174,918 (GRCm39) E50G probably damaging Het
Dis3l A T 9: 64,214,795 (GRCm39) S925T probably benign Het
Disp1 T C 1: 182,868,076 (GRCm39) N1448S probably benign Het
Dpp10 T C 1: 123,264,580 (GRCm39) I747M probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Ephx4 A T 5: 107,551,522 (GRCm39) K36* probably null Het
Fam135a C T 1: 24,053,953 (GRCm39) V1195I probably damaging Het
Fap A T 2: 62,376,947 (GRCm39) Y234* probably null Het
Fem1c A T 18: 46,638,942 (GRCm39) N353K possibly damaging Het
Furin C A 7: 80,043,365 (GRCm39) R282L probably damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm5930 A G 14: 44,568,828 (GRCm39) *265Q probably null Het
Hcrtr1 T A 4: 130,031,379 (GRCm39) T15S probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Il18r1 A T 1: 40,528,867 (GRCm39) I304L probably benign Het
Ino80 A T 2: 119,281,922 (GRCm39) Y185N probably damaging Het
Itgb2 G A 10: 77,395,507 (GRCm39) C536Y probably damaging Het
Ivns1abp T C 1: 151,236,744 (GRCm39) M435T probably benign Het
Kcnh4 T C 11: 100,647,911 (GRCm39) N151D probably benign Het
Lama3 T C 18: 12,628,405 (GRCm39) M1499T probably benign Het
Lamb1 A T 12: 31,373,461 (GRCm39) T1397S possibly damaging Het
Leng1 G A 7: 3,664,211 (GRCm39) R239* probably null Het
Map2k4 A T 11: 65,584,355 (GRCm39) N309K possibly damaging Het
Mcm3 A G 1: 20,873,768 (GRCm39) F784S probably damaging Het
Mrgpra9 T A 7: 46,884,884 (GRCm39) N260I probably benign Het
Mrnip C A 11: 50,090,679 (GRCm39) T281N possibly damaging Het
Myo9b A G 8: 71,808,501 (GRCm39) T1715A possibly damaging Het
Nectin3 A G 16: 46,269,184 (GRCm39) I406T possibly damaging Het
Neto1 A G 18: 86,516,699 (GRCm39) T339A possibly damaging Het
Ntn1 T C 11: 68,104,025 (GRCm39) D541G probably damaging Het
Nuak2 C A 1: 132,244,132 (GRCm39) H55Q probably damaging Het
Nufip2 A G 11: 77,582,439 (GRCm39) T118A probably benign Het
Or11i1 T G 3: 106,729,638 (GRCm39) N79T possibly damaging Het
Or12e7 T A 2: 87,288,271 (GRCm39) V254E probably damaging Het
Or51af1 T A 7: 103,141,858 (GRCm39) T76S probably damaging Het
Or52e19 C A 7: 102,959,000 (GRCm39) A24D probably benign Het
Or5d16 A T 2: 87,773,518 (GRCm39) Y151* probably null Het
Or5p59 T C 7: 107,702,774 (GRCm39) V86A probably benign Het
Or6d13 C T 6: 116,517,561 (GRCm39) T49M probably benign Het
Or7a40 A T 16: 16,491,784 (GRCm39) D20E probably benign Het
Or7g29 T C 9: 19,286,237 (GRCm39) *313W probably null Het
Pcdhb5 T A 18: 37,453,933 (GRCm39) H104Q probably benign Het
Phf11a T C 14: 59,514,986 (GRCm39) R232G probably damaging Het
Pik3r5 C T 11: 68,383,615 (GRCm39) T478I probably benign Het
Prkacb T A 3: 146,438,401 (GRCm39) E380V probably damaging Het
Prl7c1 G T 13: 27,957,776 (GRCm39) D221E probably damaging Het
Prr11 T A 11: 86,996,950 (GRCm39) K5* probably null Het
Prrc2b G A 2: 32,112,332 (GRCm39) G1932D probably damaging Het
Rexo1 A T 10: 80,378,845 (GRCm39) Y1064N possibly damaging Het
Rnf182 C T 13: 43,822,147 (GRCm39) Q233* probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sash1 C G 10: 8,605,291 (GRCm39) G1033A probably benign Het
Sncaip C A 18: 53,039,609 (GRCm39) S189* probably null Het
Sorl1 T C 9: 41,982,530 (GRCm39) Y350C probably damaging Het
Speg T C 1: 75,383,328 (GRCm39) V1141A possibly damaging Het
Speg C A 1: 75,406,167 (GRCm39) D3091E possibly damaging Het
Sucnr1 A T 3: 59,994,144 (GRCm39) D224V probably benign Het
Tg G A 15: 66,631,407 (GRCm39) A559T probably damaging Het
Tmem132d A G 5: 127,861,502 (GRCm39) I873T probably benign Het
Tmem229a C T 6: 24,954,920 (GRCm39) C278Y probably damaging Het
Togaram1 T C 12: 65,013,364 (GRCm39) I205T possibly damaging Het
Usp19 T A 9: 108,374,082 (GRCm39) L713Q probably damaging Het
Vsig10 A G 5: 117,489,824 (GRCm39) D530G possibly damaging Het
Zfp106 A G 2: 120,364,983 (GRCm39) S475P probably damaging Het
Other mutations in Alox12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Alox12 APN 11 70,145,375 (GRCm39) missense probably benign 0.12
IGL01629:Alox12 APN 11 70,133,660 (GRCm39) missense probably damaging 1.00
IGL02657:Alox12 APN 11 70,138,104 (GRCm39) missense probably benign
IGL02966:Alox12 APN 11 70,140,911 (GRCm39) missense probably damaging 1.00
R0243:Alox12 UTSW 11 70,133,542 (GRCm39) missense possibly damaging 0.82
R0357:Alox12 UTSW 11 70,133,362 (GRCm39) missense probably damaging 1.00
R0394:Alox12 UTSW 11 70,136,761 (GRCm39) missense probably damaging 1.00
R0422:Alox12 UTSW 11 70,145,384 (GRCm39) missense probably damaging 1.00
R0564:Alox12 UTSW 11 70,143,662 (GRCm39) missense probably damaging 0.99
R0751:Alox12 UTSW 11 70,137,776 (GRCm39) missense probably benign 0.00
R1539:Alox12 UTSW 11 70,144,069 (GRCm39) splice site probably null
R1562:Alox12 UTSW 11 70,140,991 (GRCm39) missense probably damaging 0.97
R2165:Alox12 UTSW 11 70,133,398 (GRCm39) splice site probably null
R2295:Alox12 UTSW 11 70,133,291 (GRCm39) missense probably benign 0.45
R4073:Alox12 UTSW 11 70,138,136 (GRCm39) missense probably damaging 1.00
R4558:Alox12 UTSW 11 70,143,889 (GRCm39) missense probably benign 0.03
R5081:Alox12 UTSW 11 70,146,140 (GRCm39) splice site probably null
R5198:Alox12 UTSW 11 70,145,243 (GRCm39) missense probably damaging 1.00
R5507:Alox12 UTSW 11 70,145,238 (GRCm39) missense possibly damaging 0.87
R5793:Alox12 UTSW 11 70,133,879 (GRCm39) missense probably benign 0.00
R5832:Alox12 UTSW 11 70,144,106 (GRCm39) missense probably damaging 0.98
R5975:Alox12 UTSW 11 70,133,609 (GRCm39) missense possibly damaging 0.89
R5984:Alox12 UTSW 11 70,137,881 (GRCm39) missense possibly damaging 0.83
R5988:Alox12 UTSW 11 70,142,413 (GRCm39) missense probably benign 0.05
R6030:Alox12 UTSW 11 70,145,417 (GRCm39) missense possibly damaging 0.72
R6030:Alox12 UTSW 11 70,145,417 (GRCm39) missense possibly damaging 0.72
R6248:Alox12 UTSW 11 70,143,936 (GRCm39) missense probably damaging 1.00
R7320:Alox12 UTSW 11 70,145,298 (GRCm39) missense probably benign 0.02
R7595:Alox12 UTSW 11 70,133,230 (GRCm39) missense probably damaging 1.00
R7972:Alox12 UTSW 11 70,133,513 (GRCm39) missense probably benign 0.15
R8787:Alox12 UTSW 11 70,144,146 (GRCm39) missense probably benign 0.01
R8845:Alox12 UTSW 11 70,137,877 (GRCm39) missense probably damaging 1.00
R9051:Alox12 UTSW 11 70,138,153 (GRCm39) missense possibly damaging 0.93
R9055:Alox12 UTSW 11 70,143,903 (GRCm39) missense probably damaging 0.99
R9730:Alox12 UTSW 11 70,140,920 (GRCm39) missense probably benign 0.21
R9784:Alox12 UTSW 11 70,143,665 (GRCm39) missense possibly damaging 0.91
X0025:Alox12 UTSW 11 70,146,050 (GRCm39) missense probably damaging 0.96
Z1177:Alox12 UTSW 11 70,142,305 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TAGCTCATTTGTGACGAAGGGAG -3'
(R):5'- AGTGACAGGTTTCTTATCCCGTC -3'

Sequencing Primer
(F):5'- CAGGACAAGAGGGTCAAGTATGTACC -3'
(R):5'- ATCCCGTCTACTTGAGTGTAAG -3'
Posted On 2018-06-22