Incidental Mutation 'R6613:Atp2c2'
ID523776
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene NameATPase, Ca++ transporting, type 2C, member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6613 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location119700009-119757717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119756021 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 874 (L874R)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049156] [ENSMUST00000095171]
Predicted Effect probably benign
Transcript: ENSMUST00000049156
SMART Domains Protein: ENSMUSP00000044430
Gene: ENSMUSG00000034105

DomainStartEndE-ValueType
TLDc 241 410 4.36e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095171
AA Change: L874R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: L874R

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 G A 6: 125,806,656 probably null Het
Arfgef1 A T 1: 10,194,396 I475N possibly damaging Het
Atg16l2 C T 7: 101,290,581 probably null Het
C2cd3 T A 7: 100,395,241 S343R possibly damaging Het
C4b A T 17: 34,733,565 S1167T probably damaging Het
Cacna1i G A 15: 80,321,259 G139S probably damaging Het
Chil6 A T 3: 106,389,875 F317I probably benign Het
Cngb1 A T 8: 95,266,010 V199E possibly damaging Het
Dcn A T 10: 97,495,040 T79S probably benign Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Dnajc13 A T 9: 104,213,877 D668E probably benign Het
Dnajc28 C A 16: 91,616,358 E357* probably null Het
Dock7 A G 4: 98,977,960 Y1198H probably damaging Het
Flot1 A G 17: 35,825,811 D167G probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Hyou1 A T 9: 44,382,498 I242F probably damaging Het
Igfbpl1 T C 4: 45,813,447 N256S probably benign Het
Kif20b C T 19: 34,936,984 Q390* probably null Het
Lhfpl2 T A 13: 94,174,495 F91Y probably damaging Het
Magi1 G A 6: 93,745,673 T408I probably damaging Het
Mttp T C 3: 138,109,078 N479D probably damaging Het
Myom3 T C 4: 135,812,459 V1339A possibly damaging Het
Nin T C 12: 70,030,954 K1733E probably damaging Het
Olfr173 C A 16: 58,797,531 C105F probably damaging Het
Pdzrn4 T C 15: 92,677,574 I287T probably damaging Het
Ptprt A G 2: 161,530,447 V1435A probably damaging Het
Rpap3 T C 15: 97,681,841 probably null Het
Scin A G 12: 40,079,715 Y360H probably benign Het
Sfxn5 A G 6: 85,269,908 probably null Het
Sgo1 A G 17: 53,679,057 S369P probably damaging Het
Skil T A 3: 31,097,880 C184S probably null Het
Srcin1 A G 11: 97,533,827 M607T possibly damaging Het
Ssc5d C T 7: 4,933,293 P513S possibly damaging Het
Trip10 A G 17: 57,255,197 probably null Het
Vmn2r114 T A 17: 23,310,246 Q294L possibly damaging Het
Zc3h12c A G 9: 52,116,112 V650A possibly damaging Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 119745590 missense probably benign
IGL01624:Atp2c2 APN 8 119757450 missense probably benign 0.00
IGL02133:Atp2c2 APN 8 119754335 missense probably benign 0.00
IGL02221:Atp2c2 APN 8 119744334 missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 119730274 missense probably benign
IGL02657:Atp2c2 APN 8 119753032 missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 119749120 missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 119742675 missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 119749062 missense probably benign 0.15
R0372:Atp2c2 UTSW 8 119757441 missense probably benign
R0502:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0503:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0584:Atp2c2 UTSW 8 119738418 missense probably benign 0.01
R1225:Atp2c2 UTSW 8 119735245 missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 119752987 missense probably benign 0.00
R1620:Atp2c2 UTSW 8 119749126 missense probably benign
R1638:Atp2c2 UTSW 8 119756003 missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 119725094 missense probably benign 0.02
R1746:Atp2c2 UTSW 8 119734443 unclassified probably benign
R1907:Atp2c2 UTSW 8 119749876 splice site probably benign
R2104:Atp2c2 UTSW 8 119749845 missense probably benign
R2151:Atp2c2 UTSW 8 119756102 missense probably benign
R2152:Atp2c2 UTSW 8 119756102 missense probably benign
R2154:Atp2c2 UTSW 8 119756102 missense probably benign
R2207:Atp2c2 UTSW 8 119748309 missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 119735296 missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 119721276 missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 119749871 critical splice donor site probably null
R4782:Atp2c2 UTSW 8 119749152 missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 119747687 missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 119754263 missense probably benign 0.00
R5485:Atp2c2 UTSW 8 119753062 critical splice donor site probably null
R5978:Atp2c2 UTSW 8 119749875 splice site probably null
R6377:Atp2c2 UTSW 8 119726354 missense probably benign 0.10
R6765:Atp2c2 UTSW 8 119753017 missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 119734415 missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 119730267 nonsense probably null
R7220:Atp2c2 UTSW 8 119745561 missense probably benign 0.00
R7238:Atp2c2 UTSW 8 119742421 missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 119730252 missense probably benign 0.02
R7438:Atp2c2 UTSW 8 119748197 missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 119751269 missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 119748176 missense probably benign 0.00
R7737:Atp2c2 UTSW 8 119742395 missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 119730178 missense possibly damaging 0.81
R7993:Atp2c2 UTSW 8 119730178 missense possibly damaging 0.81
RF004:Atp2c2 UTSW 8 119752822 missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 119745514 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCTTTCATTCCATCAGGGGC -3'
(R):5'- TGCCACAGAACAGAAGCCTG -3'

Sequencing Primer
(F):5'- TTCCATCAGGGGCTCCAAC -3'
(R):5'- AGAAGCCTGTGGACTAGCCTG -3'
Posted On2018-06-22