Incidental Mutation 'R6613:Atp2c2'
ID 523776
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
MMRRC Submission 044736-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6613 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 120482760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 874 (L874R)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049156] [ENSMUST00000095171]
AlphaFold A7L9Z8
Predicted Effect probably benign
Transcript: ENSMUST00000049156
SMART Domains Protein: ENSMUSP00000044430
Gene: ENSMUSG00000034105

DomainStartEndE-ValueType
TLDc 241 410 4.36e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095171
AA Change: L874R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: L874R

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 G A 6: 125,783,619 (GRCm39) probably null Het
Arfgef1 A T 1: 10,264,621 (GRCm39) I475N possibly damaging Het
Atg16l2 C T 7: 100,939,788 (GRCm39) probably null Het
C2cd3 T A 7: 100,044,448 (GRCm39) S343R possibly damaging Het
C4b A T 17: 34,952,539 (GRCm39) S1167T probably damaging Het
Cacna1i G A 15: 80,205,460 (GRCm39) G139S probably damaging Het
Chil6 A T 3: 106,297,191 (GRCm39) F317I probably benign Het
Cngb1 A T 8: 95,992,638 (GRCm39) V199E possibly damaging Het
Dcn A T 10: 97,330,902 (GRCm39) T79S probably benign Het
Dcxr A G 11: 120,617,832 (GRCm39) V48A probably benign Het
Dnajc13 A T 9: 104,091,076 (GRCm39) D668E probably benign Het
Dnajc28 C A 16: 91,413,246 (GRCm39) E357* probably null Het
Dock7 A G 4: 98,866,197 (GRCm39) Y1198H probably damaging Het
Flot1 A G 17: 36,136,703 (GRCm39) D167G probably damaging Het
Gpn1 T C 5: 31,654,696 (GRCm39) probably null Het
Hyou1 A T 9: 44,293,795 (GRCm39) I242F probably damaging Het
Igfbpl1 T C 4: 45,813,447 (GRCm39) N256S probably benign Het
Kif20b C T 19: 34,914,384 (GRCm39) Q390* probably null Het
Lhfpl2 T A 13: 94,311,003 (GRCm39) F91Y probably damaging Het
Magi1 G A 6: 93,722,654 (GRCm39) T408I probably damaging Het
Mttp T C 3: 137,814,839 (GRCm39) N479D probably damaging Het
Myom3 T C 4: 135,539,770 (GRCm39) V1339A possibly damaging Het
Nin T C 12: 70,077,728 (GRCm39) K1733E probably damaging Het
Or5k1 C A 16: 58,617,894 (GRCm39) C105F probably damaging Het
Pdzrn4 T C 15: 92,575,455 (GRCm39) I287T probably damaging Het
Ptprt A G 2: 161,372,367 (GRCm39) V1435A probably damaging Het
Rpap3 T C 15: 97,579,722 (GRCm39) probably null Het
Scin A G 12: 40,129,714 (GRCm39) Y360H probably benign Het
Sfxn5 A G 6: 85,246,890 (GRCm39) probably null Het
Sgo1 A G 17: 53,986,085 (GRCm39) S369P probably damaging Het
Skil T A 3: 31,152,029 (GRCm39) C184S probably null Het
Srcin1 A G 11: 97,424,653 (GRCm39) M607T possibly damaging Het
Ssc5d C T 7: 4,936,292 (GRCm39) P513S possibly damaging Het
Trip10 A G 17: 57,562,197 (GRCm39) probably null Het
Vmn2r114 T A 17: 23,529,220 (GRCm39) Q294L possibly damaging Het
Zc3h12c A G 9: 52,027,412 (GRCm39) V650A possibly damaging Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTTTCATTCCATCAGGGGC -3'
(R):5'- TGCCACAGAACAGAAGCCTG -3'

Sequencing Primer
(F):5'- TTCCATCAGGGGCTCCAAC -3'
(R):5'- AGAAGCCTGTGGACTAGCCTG -3'
Posted On 2018-06-22