Mutagenetix > Incidental Mutation

Incidental Mutation 'R6613:Atp2c2'

523776

Institutional Source

Beutler Lab

Gene Symbol

Atp2c2

Ensembl Gene

ENSMUSG00000034112

Gene Name

ATPase, Ca++ transporting, type 2C, member 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6613 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119700009-119757717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 119756021 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 874 (L874R)

Ref Sequence

ENSEMBL: ENSMUSP00000092794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049156] [ENSMUST00000095171]

AlphaFold

A7L9Z8

Predicted Effect

probably benign
Transcript: ENSMUST00000049156

SMART Domains

Protein: ENSMUSP00000044430
Gene: ENSMUSG00000034105

Domain	Start	End	E-Value	Type
TLDc	241	410	4.36e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000095171
AA Change: L874R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: L874R

Domain	Start	End	E-Value	Type
Cation_ATPase_N	54	128	1.27e-12	SMART
Pfam:E1-E2_ATPase	133	366	1.7e-62	PFAM
Pfam:Hydrolase	371	684	5.3e-18	PFAM
Pfam:HAD	374	681	7.4e-11	PFAM
Pfam:Cation_ATPase	437	521	1.1e-17	PFAM
Pfam:Cation_ATPase_C	754	927	1.1e-47	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.9%

Validation Efficiency

97% (37/38)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano2	G	A	6: 125,806,656		probably null	Het
Arfgef1	A	T	1: 10,194,396	I475N	possibly damaging	Het
Atg16l2	C	T	7: 101,290,581		probably null	Het
C2cd3	T	A	7: 100,395,241	S343R	possibly damaging	Het
C4b	A	T	17: 34,733,565	S1167T	probably damaging	Het
Cacna1i	G	A	15: 80,321,259	G139S	probably damaging	Het
Chil6	A	T	3: 106,389,875	F317I	probably benign	Het
Cngb1	A	T	8: 95,266,010	V199E	possibly damaging	Het
Dcn	A	T	10: 97,495,040	T79S	probably benign	Het
Dcxr	A	G	11: 120,727,006	V48A	probably benign	Het
Dnajc13	A	T	9: 104,213,877	D668E	probably benign	Het
Dnajc28	C	A	16: 91,616,358	E357*	probably null	Het
Dock7	A	G	4: 98,977,960	Y1198H	probably damaging	Het
Flot1	A	G	17: 35,825,811	D167G	probably damaging	Het
Gpn1	T	C	5: 31,497,352		probably null	Het
Hyou1	A	T	9: 44,382,498	I242F	probably damaging	Het
Igfbpl1	T	C	4: 45,813,447	N256S	probably benign	Het
Kif20b	C	T	19: 34,936,984	Q390*	probably null	Het
Lhfpl2	T	A	13: 94,174,495	F91Y	probably damaging	Het
Magi1	G	A	6: 93,745,673	T408I	probably damaging	Het
Mttp	T	C	3: 138,109,078	N479D	probably damaging	Het
Myom3	T	C	4: 135,812,459	V1339A	possibly damaging	Het
Nin	T	C	12: 70,030,954	K1733E	probably damaging	Het
Olfr173	C	A	16: 58,797,531	C105F	probably damaging	Het
Pdzrn4	T	C	15: 92,677,574	I287T	probably damaging	Het
Ptprt	A	G	2: 161,530,447	V1435A	probably damaging	Het
Rpap3	T	C	15: 97,681,841		probably null	Het
Scin	A	G	12: 40,079,715	Y360H	probably benign	Het
Sfxn5	A	G	6: 85,269,908		probably null	Het
Sgo1	A	G	17: 53,679,057	S369P	probably damaging	Het
Skil	T	A	3: 31,097,880	C184S	probably null	Het
Srcin1	A	G	11: 97,533,827	M607T	possibly damaging	Het
Ssc5d	C	T	7: 4,933,293	P513S	possibly damaging	Het
Trip10	A	G	17: 57,255,197		probably null	Het
Vmn2r114	T	A	17: 23,310,246	Q294L	possibly damaging	Het
Zc3h12c	A	G	9: 52,116,112	V650A	possibly damaging	Het

Other mutations in Atp2c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Atp2c2	APN	8	119745590	missense	probably benign
IGL01624:Atp2c2	APN	8	119757450	missense	probably benign	0.00
IGL02133:Atp2c2	APN	8	119754335	missense	probably benign	0.00
IGL02221:Atp2c2	APN	8	119744334	missense	probably damaging	1.00
IGL02606:Atp2c2	APN	8	119730274	missense	probably benign
IGL02657:Atp2c2	APN	8	119753032	missense	probably damaging	1.00
IGL02839:Atp2c2	APN	8	119749120	missense	possibly damaging	0.85
IGL03122:Atp2c2	APN	8	119742675	missense	possibly damaging	0.77
R0031:Atp2c2	UTSW	8	119749062	missense	probably benign	0.15
R0372:Atp2c2	UTSW	8	119757441	missense	probably benign
R0502:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0503:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0584:Atp2c2	UTSW	8	119738418	missense	probably benign	0.01
R1225:Atp2c2	UTSW	8	119735245	missense	probably damaging	1.00
R1580:Atp2c2	UTSW	8	119752987	missense	probably benign	0.00
R1620:Atp2c2	UTSW	8	119749126	missense	probably benign
R1638:Atp2c2	UTSW	8	119756003	missense	possibly damaging	0.82
R1745:Atp2c2	UTSW	8	119725094	missense	probably benign	0.02
R1746:Atp2c2	UTSW	8	119734443	unclassified	probably benign
R1907:Atp2c2	UTSW	8	119749876	splice site	probably benign
R2104:Atp2c2	UTSW	8	119749845	missense	probably benign
R2151:Atp2c2	UTSW	8	119756102	missense	probably benign
R2152:Atp2c2	UTSW	8	119756102	missense	probably benign
R2154:Atp2c2	UTSW	8	119756102	missense	probably benign
R2207:Atp2c2	UTSW	8	119748309	missense	probably damaging	1.00
R3874:Atp2c2	UTSW	8	119735296	missense	possibly damaging	0.74
R3912:Atp2c2	UTSW	8	119721276	missense	probably damaging	1.00
R4093:Atp2c2	UTSW	8	119749871	critical splice donor site	probably null
R4782:Atp2c2	UTSW	8	119749152	missense	probably damaging	0.97
R4801:Atp2c2	UTSW	8	119747687	missense	probably damaging	1.00
R4973:Atp2c2	UTSW	8	119754263	missense	probably benign	0.00
R5485:Atp2c2	UTSW	8	119753062	critical splice donor site	probably null
R5978:Atp2c2	UTSW	8	119749875	splice site	probably null
R6377:Atp2c2	UTSW	8	119726354	missense	probably benign	0.10
R6765:Atp2c2	UTSW	8	119753017	missense	probably damaging	1.00
R6836:Atp2c2	UTSW	8	119734415	missense	probably damaging	1.00
R6963:Atp2c2	UTSW	8	119730267	nonsense	probably null
R7220:Atp2c2	UTSW	8	119745561	missense	probably benign	0.00
R7238:Atp2c2	UTSW	8	119742421	missense	possibly damaging	0.73
R7373:Atp2c2	UTSW	8	119730252	missense	probably benign	0.02
R7438:Atp2c2	UTSW	8	119748197	missense	probably damaging	1.00
R7573:Atp2c2	UTSW	8	119751269	missense	probably damaging	1.00
R7677:Atp2c2	UTSW	8	119748176	missense	probably benign	0.00
R7737:Atp2c2	UTSW	8	119742395	missense	probably damaging	1.00
R7912:Atp2c2	UTSW	8	119730178	missense	possibly damaging	0.81
R8821:Atp2c2	UTSW	8	119749294	splice site	probably null
R8831:Atp2c2	UTSW	8	119749294	splice site	probably null
R9200:Atp2c2	UTSW	8	119748260	nonsense	probably null
R9211:Atp2c2	UTSW	8	119719293	missense	probably benign
R9246:Atp2c2	UTSW	8	119730250	missense	probably damaging	1.00
R9285:Atp2c2	UTSW	8	119738402	missense	probably benign	0.00
RF004:Atp2c2	UTSW	8	119752822	missense	probably damaging	1.00
RF012:Atp2c2	UTSW	8	119745514	missense	possibly damaging	0.91
Z1177:Atp2c2	UTSW	8	119734385	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCTTTCATTCCATCAGGGGC -3'
(R):5'- TGCCACAGAACAGAAGCCTG -3'

Sequencing Primer
(F):5'- TTCCATCAGGGGCTCCAAC -3'
(R):5'- AGAAGCCTGTGGACTAGCCTG -3'

Posted On

2018-06-22