Incidental Mutation 'R6613:Hyou1'
ID 523778
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Name hypoxia up-regulated 1
Synonyms 140 kDa, Orp150, Cab140, Grp170, CBP-140
MMRRC Submission 044736-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6613 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 44290840-44303662 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 44293795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 242 (I242F)
Ref Sequence ENSEMBL: ENSMUSP00000123700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560] [ENSMUST00000217019]
AlphaFold Q9JKR6
Predicted Effect probably damaging
Transcript: ENSMUST00000066601
AA Change: I242F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: I242F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159473
AA Change: I191F

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115
AA Change: I191F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect probably damaging
Transcript: ENSMUST00000160902
AA Change: I242F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: I242F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161318
AA Change: I242F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: I242F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217460
Meta Mutation Damage Score 0.7709 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 G A 6: 125,783,619 (GRCm39) probably null Het
Arfgef1 A T 1: 10,264,621 (GRCm39) I475N possibly damaging Het
Atg16l2 C T 7: 100,939,788 (GRCm39) probably null Het
Atp2c2 T G 8: 120,482,760 (GRCm39) L874R probably damaging Het
C2cd3 T A 7: 100,044,448 (GRCm39) S343R possibly damaging Het
C4b A T 17: 34,952,539 (GRCm39) S1167T probably damaging Het
Cacna1i G A 15: 80,205,460 (GRCm39) G139S probably damaging Het
Chil6 A T 3: 106,297,191 (GRCm39) F317I probably benign Het
Cngb1 A T 8: 95,992,638 (GRCm39) V199E possibly damaging Het
Dcn A T 10: 97,330,902 (GRCm39) T79S probably benign Het
Dcxr A G 11: 120,617,832 (GRCm39) V48A probably benign Het
Dnajc13 A T 9: 104,091,076 (GRCm39) D668E probably benign Het
Dnajc28 C A 16: 91,413,246 (GRCm39) E357* probably null Het
Dock7 A G 4: 98,866,197 (GRCm39) Y1198H probably damaging Het
Flot1 A G 17: 36,136,703 (GRCm39) D167G probably damaging Het
Gpn1 T C 5: 31,654,696 (GRCm39) probably null Het
Igfbpl1 T C 4: 45,813,447 (GRCm39) N256S probably benign Het
Kif20b C T 19: 34,914,384 (GRCm39) Q390* probably null Het
Lhfpl2 T A 13: 94,311,003 (GRCm39) F91Y probably damaging Het
Magi1 G A 6: 93,722,654 (GRCm39) T408I probably damaging Het
Mttp T C 3: 137,814,839 (GRCm39) N479D probably damaging Het
Myom3 T C 4: 135,539,770 (GRCm39) V1339A possibly damaging Het
Nin T C 12: 70,077,728 (GRCm39) K1733E probably damaging Het
Or5k1 C A 16: 58,617,894 (GRCm39) C105F probably damaging Het
Pdzrn4 T C 15: 92,575,455 (GRCm39) I287T probably damaging Het
Ptprt A G 2: 161,372,367 (GRCm39) V1435A probably damaging Het
Rpap3 T C 15: 97,579,722 (GRCm39) probably null Het
Scin A G 12: 40,129,714 (GRCm39) Y360H probably benign Het
Sfxn5 A G 6: 85,246,890 (GRCm39) probably null Het
Sgo1 A G 17: 53,986,085 (GRCm39) S369P probably damaging Het
Skil T A 3: 31,152,029 (GRCm39) C184S probably null Het
Srcin1 A G 11: 97,424,653 (GRCm39) M607T possibly damaging Het
Ssc5d C T 7: 4,936,292 (GRCm39) P513S possibly damaging Het
Trip10 A G 17: 57,562,197 (GRCm39) probably null Het
Vmn2r114 T A 17: 23,529,220 (GRCm39) Q294L possibly damaging Het
Zc3h12c A G 9: 52,027,412 (GRCm39) V650A possibly damaging Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44,296,443 (GRCm39) missense probably benign 0.02
IGL01660:Hyou1 APN 9 44,292,414 (GRCm39) missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44,293,309 (GRCm39) missense probably benign 0.21
IGL01903:Hyou1 APN 9 44,292,438 (GRCm39) splice site probably benign
IGL02636:Hyou1 APN 9 44,292,707 (GRCm39) critical splice donor site probably null
IGL02806:Hyou1 APN 9 44,300,180 (GRCm39) nonsense probably null
IGL03401:Hyou1 APN 9 44,296,206 (GRCm39) missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44,299,355 (GRCm39) missense probably benign
ANU74:Hyou1 UTSW 9 44,292,560 (GRCm39) missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44,295,774 (GRCm39) missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44,302,148 (GRCm39) missense probably benign 0.26
R0408:Hyou1 UTSW 9 44,295,989 (GRCm39) missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44,300,539 (GRCm39) missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44,295,978 (GRCm39) missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44,300,167 (GRCm39) missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44,300,703 (GRCm39) missense probably benign 0.02
R1803:Hyou1 UTSW 9 44,295,479 (GRCm39) nonsense probably null
R2060:Hyou1 UTSW 9 44,292,849 (GRCm39) missense probably benign 0.28
R2180:Hyou1 UTSW 9 44,299,316 (GRCm39) missense probably benign 0.30
R2233:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R2235:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R3950:Hyou1 UTSW 9 44,296,524 (GRCm39) missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44,291,912 (GRCm39) splice site probably null
R4393:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44,298,418 (GRCm39) intron probably benign
R5239:Hyou1 UTSW 9 44,296,560 (GRCm39) missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44,296,546 (GRCm39) missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44,300,223 (GRCm39) critical splice donor site probably null
R5856:Hyou1 UTSW 9 44,292,641 (GRCm39) missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44,293,322 (GRCm39) critical splice donor site probably null
R6594:Hyou1 UTSW 9 44,300,619 (GRCm39) missense probably benign
R6596:Hyou1 UTSW 9 44,299,052 (GRCm39) missense probably benign 0.00
R6704:Hyou1 UTSW 9 44,292,431 (GRCm39) critical splice donor site probably null
R6849:Hyou1 UTSW 9 44,298,561 (GRCm39) missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44,300,706 (GRCm39) missense probably benign 0.04
R7632:Hyou1 UTSW 9 44,292,433 (GRCm39) splice site probably null
R7711:Hyou1 UTSW 9 44,295,759 (GRCm39) missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44,296,882 (GRCm39) missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44,299,430 (GRCm39) missense probably benign 0.26
R9352:Hyou1 UTSW 9 44,300,926 (GRCm39) critical splice donor site probably null
R9385:Hyou1 UTSW 9 44,292,812 (GRCm39) missense probably benign 0.06
X0027:Hyou1 UTSW 9 44,302,153 (GRCm39) missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44,299,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGCATCCTGCATTTGATAAAC -3'
(R):5'- TGTCTTCTTTGGGAGCAGCC -3'

Sequencing Primer
(F):5'- TAACTCACTGTGTAAGCCAGGCTG -3'
(R):5'- CCTTCCAGAAACCCATGCTGTATC -3'
Posted On 2018-06-22