Mutagenetix > Incidental Mutations

Incidental Mutation 'R6505:Brca1'

523781

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6505 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101523541 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1256 (M1256L)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

AlphaFold

P48754

Predicted Effect

probably benign
Transcript: ENSMUST00000017290
AA Change: M1256L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: M1256L

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131460

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188168

Predicted Effect

probably benign
Transcript: ENSMUST00000191198

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	T	17: 9,001,940	I424L	probably benign	Het
2610028H24Rik	C	T	10: 76,449,281	A8V	probably benign	Het
Ago1	G	A	4: 126,463,835	P16S	probably benign	Het
Ak5	C	T	3: 152,481,669	E394K	probably benign	Het
Aldh7a1	T	C	18: 56,526,996	Y498C	probably damaging	Het
Alox12	T	A	11: 70,250,204	D335V	probably damaging	Het
Alx4	A	T	2: 93,668,559	Y212F	probably damaging	Het
Asb16	A	G	11: 102,276,477	E223G	probably damaging	Het
Atg9b	C	T	5: 24,390,577	V235M	probably damaging	Het
BB014433	A	G	8: 15,042,304	V183A	probably benign	Het
Bst1	A	G	5: 43,820,590	I94V	probably benign	Het
C3ar1	A	G	6: 122,850,640	L206P	probably benign	Het
Cabs1	T	A	5: 87,980,663	M391K	possibly damaging	Het
Cars	C	T	7: 143,565,007	R599Q	probably damaging	Het
Ccdc190	T	A	1: 169,933,023	Y73*	probably null	Het
Cd177	A	C	7: 24,744,246	L809W	probably benign	Het
Cemip	C	A	7: 83,951,597	G939*	probably null	Het
Clca3b	T	A	3: 144,825,259	I777F	probably benign	Het
Cma2	T	C	14: 55,973,779	I176T	probably damaging	Het
Col12a1	T	A	9: 79,647,605	T2064S	probably damaging	Het
Csf1r	A	G	18: 61,129,733	N860S	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dennd4b	A	G	3: 90,267,611	E50G	probably damaging	Het
Dis3l	A	T	9: 64,307,513	S925T	probably benign	Het
Disp1	T	C	1: 183,086,512	N1448S	probably benign	Het
Dpp10	T	C	1: 123,336,851	I747M	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ephx4	A	T	5: 107,403,656	K36*	probably null	Het
Fam135a	C	T	1: 24,014,872	V1195I	probably damaging	Het
Fap	A	T	2: 62,546,603	Y234*	probably null	Het
Fem1c	A	T	18: 46,505,875	N353K	possibly damaging	Het
Furin	C	A	7: 80,393,617	R282L	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm5930	A	G	14: 44,331,371	*265Q	probably null	Het
Hcrtr1	T	A	4: 130,137,586	T15S	probably benign	Het
Ifnar1	C	T	16: 91,499,537	Q309*	probably null	Het
Il18r1	A	T	1: 40,489,707	I304L	probably benign	Het
Ino80	A	T	2: 119,451,441	Y185N	probably damaging	Het
Itgb2	G	A	10: 77,559,673	C536Y	probably damaging	Het
Ivns1abp	T	C	1: 151,360,993	M435T	probably benign	Het
Kcnh4	T	C	11: 100,757,085	N151D	probably benign	Het
Lama3	T	C	18: 12,495,348	M1499T	probably benign	Het
Lamb1	A	T	12: 31,323,462	T1397S	possibly damaging	Het
Leng1	G	A	7: 3,661,212	R239*	probably null	Het
Map2k4	A	T	11: 65,693,529	N309K	possibly damaging	Het
Mcm3	A	G	1: 20,803,544	F784S	probably damaging	Het
Mrgpra9	T	A	7: 47,235,136	N260I	probably benign	Het
Mrnip	C	A	11: 50,199,852	T281N	possibly damaging	Het
Myo9b	A	G	8: 71,355,857	T1715A	possibly damaging	Het
Nectin3	A	G	16: 46,448,821	I406T	possibly damaging	Het
Neto1	A	G	18: 86,498,574	T339A	possibly damaging	Het
Ntn1	T	C	11: 68,213,199	D541G	probably damaging	Het
Nuak2	C	A	1: 132,316,394	H55Q	probably damaging	Het
Nufip2	A	G	11: 77,691,613	T118A	probably benign	Het
Olfr1126	T	A	2: 87,457,927	V254E	probably damaging	Het
Olfr1155	A	T	2: 87,943,174	Y151*	probably null	Het
Olfr19	A	T	16: 16,673,920	D20E	probably benign	Het
Olfr213	C	T	6: 116,540,600	T49M	probably benign	Het
Olfr266	T	G	3: 106,822,322	N79T	possibly damaging	Het
Olfr483	T	C	7: 108,103,567	V86A	probably benign	Het
Olfr596	C	A	7: 103,309,793	A24D	probably benign	Het
Olfr609	T	A	7: 103,492,651	T76S	probably damaging	Het
Olfr847	T	C	9: 19,374,941	*313W	probably null	Het
Pcdhb5	T	A	18: 37,320,880	H104Q	probably benign	Het
Phf11a	T	C	14: 59,277,537	R232G	probably damaging	Het
Pik3r5	C	T	11: 68,492,789	T478I	probably benign	Het
Prkacb	T	A	3: 146,732,646	E380V	probably damaging	Het
Prl7c1	G	T	13: 27,773,793	D221E	probably damaging	Het
Prr11	T	A	11: 87,106,124	K5*	probably null	Het
Prrc2b	G	A	2: 32,222,320	G1932D	probably damaging	Het
Rexo1	A	T	10: 80,543,011	Y1064N	possibly damaging	Het
Rnf182	C	T	13: 43,668,671	Q233*	probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sash1	C	G	10: 8,729,527	G1033A	probably benign	Het
Sncaip	C	A	18: 52,906,537	S189*	probably null	Het
Sorl1	T	C	9: 42,071,234	Y350C	probably damaging	Het
Speg	T	C	1: 75,406,684	V1141A	possibly damaging	Het
Speg	C	A	1: 75,429,523	D3091E	possibly damaging	Het
Sucnr1	A	T	3: 60,086,723	D224V	probably benign	Het
Tg	G	A	15: 66,759,558	A559T	probably damaging	Het
Tmem132d	A	G	5: 127,784,438	I873T	probably benign	Het
Tmem229a	C	T	6: 24,954,921	C278Y	probably damaging	Het
Togaram1	T	C	12: 64,966,590	I205T	possibly damaging	Het
Usp19	T	A	9: 108,496,883	L713Q	probably damaging	Het
Vsig10	A	G	5: 117,351,759	D530G	possibly damaging	Het
Zfp106	A	G	2: 120,534,502	S475P	probably damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCCTCTTCTAGGCAAGTTGC -3'
(R):5'- AAGAGAGCGACTCCACTGAG -3'

Sequencing Primer
(F):5'- GCAAGTTGCCATTTCCTCG -3'
(R):5'- CACTGAGGATGAAGATCTTCCCTG -3'

Posted On

2018-06-22