Mutagenetix > Incidental Mutation

Incidental Mutation 'R6505:Tg'

523798

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000053469

Gene Name

thyroglobulin

Synonyms

Tgn

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R6505 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66670753-66850721 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 66759558 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 559 (A559T)

Ref Sequence

ENSEMBL: ENSMUSP00000126454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495] [ENSMUST00000171045]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000065916
AA Change: A2178T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: A2178T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TY	50	97	5.9e-16	SMART
TY	118	165	5.59e-17	SMART
Pfam:Thyroglobulin_1	174	252	4e-9	PFAM
TY	317	363	4.36e-19	SMART
low complexity region	495	504	N/A	INTRINSIC
TY	617	662	3.58e-15	SMART
TY	684	730	1.47e-16	SMART
TY	880	926	1.51e-4	SMART
TY	1029	1078	1.21e-12	SMART
TY	1106	1150	7.56e-5	SMART
TY	1167	1215	7.26e-16	SMART
low complexity region	1244	1255	N/A	INTRINSIC
Pfam:GCC2_GCC3	1464	1509	2.7e-16	PFAM
TY	1519	1568	9.81e-13	SMART
Pfam:COesterase	2181	2717	8.4e-140	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163495

SMART Domains

Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

Domain	Start	End	E-Value	Type
TY	14	63	1.21e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171045
AA Change: A559T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: A559T

Domain	Start	End	E-Value	Type
internal_repeat_1	93	331	1.53e-6	PROSPERO
Pfam:COesterase	562	1098	2.1e-137	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172153

SMART Domains

Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

Domain	Start	End	E-Value	Type
Pfam:COesterase	313	849	6e-140	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	T	17: 9,001,940	I424L	probably benign	Het
2610028H24Rik	C	T	10: 76,449,281	A8V	probably benign	Het
Ago1	G	A	4: 126,463,835	P16S	probably benign	Het
Ak5	C	T	3: 152,481,669	E394K	probably benign	Het
Aldh7a1	T	C	18: 56,526,996	Y498C	probably damaging	Het
Alox12	T	A	11: 70,250,204	D335V	probably damaging	Het
Alx4	A	T	2: 93,668,559	Y212F	probably damaging	Het
Asb16	A	G	11: 102,276,477	E223G	probably damaging	Het
Atg9b	C	T	5: 24,390,577	V235M	probably damaging	Het
BB014433	A	G	8: 15,042,304	V183A	probably benign	Het
Brca1	T	A	11: 101,523,541	M1256L	probably benign	Het
Bst1	A	G	5: 43,820,590	I94V	probably benign	Het
C3ar1	A	G	6: 122,850,640	L206P	probably benign	Het
Cabs1	T	A	5: 87,980,663	M391K	possibly damaging	Het
Cars	C	T	7: 143,565,007	R599Q	probably damaging	Het
Ccdc190	T	A	1: 169,933,023	Y73*	probably null	Het
Cd177	A	C	7: 24,744,246	L809W	probably benign	Het
Cemip	C	A	7: 83,951,597	G939*	probably null	Het
Clca3b	T	A	3: 144,825,259	I777F	probably benign	Het
Cma2	T	C	14: 55,973,779	I176T	probably damaging	Het
Col12a1	T	A	9: 79,647,605	T2064S	probably damaging	Het
Csf1r	A	G	18: 61,129,733	N860S	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dennd4b	A	G	3: 90,267,611	E50G	probably damaging	Het
Dis3l	A	T	9: 64,307,513	S925T	probably benign	Het
Disp1	T	C	1: 183,086,512	N1448S	probably benign	Het
Dpp10	T	C	1: 123,336,851	I747M	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ephx4	A	T	5: 107,403,656	K36*	probably null	Het
Fam135a	C	T	1: 24,014,872	V1195I	probably damaging	Het
Fap	A	T	2: 62,546,603	Y234*	probably null	Het
Fem1c	A	T	18: 46,505,875	N353K	possibly damaging	Het
Furin	C	A	7: 80,393,617	R282L	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm5930	A	G	14: 44,331,371	*265Q	probably null	Het
Hcrtr1	T	A	4: 130,137,586	T15S	probably benign	Het
Ifnar1	C	T	16: 91,499,537	Q309*	probably null	Het
Il18r1	A	T	1: 40,489,707	I304L	probably benign	Het
Ino80	A	T	2: 119,451,441	Y185N	probably damaging	Het
Itgb2	G	A	10: 77,559,673	C536Y	probably damaging	Het
Ivns1abp	T	C	1: 151,360,993	M435T	probably benign	Het
Kcnh4	T	C	11: 100,757,085	N151D	probably benign	Het
Lama3	T	C	18: 12,495,348	M1499T	probably benign	Het
Lamb1	A	T	12: 31,323,462	T1397S	possibly damaging	Het
Leng1	G	A	7: 3,661,212	R239*	probably null	Het
Map2k4	A	T	11: 65,693,529	N309K	possibly damaging	Het
Mcm3	A	G	1: 20,803,544	F784S	probably damaging	Het
Mrgpra9	T	A	7: 47,235,136	N260I	probably benign	Het
Mrnip	C	A	11: 50,199,852	T281N	possibly damaging	Het
Myo9b	A	G	8: 71,355,857	T1715A	possibly damaging	Het
Nectin3	A	G	16: 46,448,821	I406T	possibly damaging	Het
Neto1	A	G	18: 86,498,574	T339A	possibly damaging	Het
Ntn1	T	C	11: 68,213,199	D541G	probably damaging	Het
Nuak2	C	A	1: 132,316,394	H55Q	probably damaging	Het
Nufip2	A	G	11: 77,691,613	T118A	probably benign	Het
Olfr1126	T	A	2: 87,457,927	V254E	probably damaging	Het
Olfr1155	A	T	2: 87,943,174	Y151*	probably null	Het
Olfr19	A	T	16: 16,673,920	D20E	probably benign	Het
Olfr213	C	T	6: 116,540,600	T49M	probably benign	Het
Olfr266	T	G	3: 106,822,322	N79T	possibly damaging	Het
Olfr483	T	C	7: 108,103,567	V86A	probably benign	Het
Olfr596	C	A	7: 103,309,793	A24D	probably benign	Het
Olfr609	T	A	7: 103,492,651	T76S	probably damaging	Het
Olfr847	T	C	9: 19,374,941	*313W	probably null	Het
Pcdhb5	T	A	18: 37,320,880	H104Q	probably benign	Het
Phf11a	T	C	14: 59,277,537	R232G	probably damaging	Het
Pik3r5	C	T	11: 68,492,789	T478I	probably benign	Het
Prkacb	T	A	3: 146,732,646	E380V	probably damaging	Het
Prl7c1	G	T	13: 27,773,793	D221E	probably damaging	Het
Prr11	T	A	11: 87,106,124	K5*	probably null	Het
Prrc2b	G	A	2: 32,222,320	G1932D	probably damaging	Het
Rexo1	A	T	10: 80,543,011	Y1064N	possibly damaging	Het
Rnf182	C	T	13: 43,668,671	Q233*	probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sash1	C	G	10: 8,729,527	G1033A	probably benign	Het
Sncaip	C	A	18: 52,906,537	S189*	probably null	Het
Sorl1	T	C	9: 42,071,234	Y350C	probably damaging	Het
Speg	T	C	1: 75,406,684	V1141A	possibly damaging	Het
Speg	C	A	1: 75,429,523	D3091E	possibly damaging	Het
Sucnr1	A	T	3: 60,086,723	D224V	probably benign	Het
Tmem132d	A	G	5: 127,784,438	I873T	probably benign	Het
Tmem229a	C	T	6: 24,954,921	C278Y	probably damaging	Het
Togaram1	T	C	12: 64,966,590	I205T	possibly damaging	Het
Usp19	T	A	9: 108,496,883	L713Q	probably damaging	Het
Vsig10	A	G	5: 117,351,759	D530G	possibly damaging	Het
Zfp106	A	G	2: 120,534,502	S475P	probably damaging	Het

Other mutations in Tg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Tg	APN	15	66847166	missense	probably damaging	1.00
IGL00230:Tg	APN	15	66827290	missense	probably benign	0.00
IGL00324:Tg	APN	15	66693424	missense	probably benign
IGL00428:Tg	APN	15	66773424	missense	probably benign	0.33
IGL00703:Tg	APN	15	66696489	missense	probably benign	0.34
IGL00808:Tg	APN	15	66683813	missense	probably damaging	1.00
IGL00833:Tg	APN	15	66688801	missense	probably benign	0.34
IGL00899:Tg	APN	15	66674073	critical splice donor site	probably null
IGL00921:Tg	APN	15	66764453	missense	probably benign	0.28
IGL00975:Tg	APN	15	66681882	missense	probably benign
IGL01288:Tg	APN	15	66736276	missense	possibly damaging	0.81
IGL01397:Tg	APN	15	66696092	splice site	probably benign
IGL01634:Tg	APN	15	66729566	missense	probably benign	0.34
IGL01646:Tg	APN	15	66678087	missense	probably damaging	1.00
IGL01704:Tg	APN	15	66671351	missense	probably damaging	0.98
IGL01958:Tg	APN	15	66759486	missense	probably benign	0.06
IGL02093:Tg	APN	15	66692374	missense	possibly damaging	0.83
IGL02113:Tg	APN	15	66705330	missense	probably benign	0.08
IGL02138:Tg	APN	15	66717233	missense	probably benign	0.01
IGL02156:Tg	APN	15	66705348	missense	probably benign	0.19
IGL02169:Tg	APN	15	66757943	missense	probably benign	0.04
IGL02342:Tg	APN	15	66764291	missense	probably benign
IGL02434:Tg	APN	15	66764342	missense	probably damaging	0.97
IGL02506:Tg	APN	15	66741594	missense	possibly damaging	0.71
IGL02513:Tg	APN	15	66705274	missense	probably benign
IGL02549:Tg	APN	15	66839361	missense	probably damaging	1.00
IGL02669:Tg	APN	15	66748726	splice site	probably benign
IGL02756:Tg	APN	15	66734586	missense	probably benign
IGL02800:Tg	APN	15	66757886	missense	probably damaging	1.00
IGL02828:Tg	APN	15	66682394	missense	probably damaging	1.00
IGL02927:Tg	APN	15	66678093	missense	probably damaging	1.00
IGL03061:Tg	APN	15	66671405	missense	probably damaging	1.00
IGL03105:Tg	APN	15	66715106	missense	probably benign	0.01
IGL03160:Tg	APN	15	66839303	nonsense	probably null
IGL03242:Tg	APN	15	66683798	missense	probably damaging	0.99
Also_ran	UTSW	15	66678839	missense	probably damaging	1.00
bedraggled	UTSW	15	66740714	missense	probably damaging	1.00
foster	UTSW	15	66693260	nonsense	probably null
hognose	UTSW	15	66717208	missense	probably damaging	0.99
ito	UTSW	15	66766162	nonsense	probably null
ito2	UTSW	15	66671396	missense	probably damaging	1.00
ito3	UTSW	15	66773474	missense	probably damaging	1.00
ito4	UTSW	15	66696520	missense	possibly damaging	0.47
Papua	UTSW	15	66674050	missense	probably damaging	1.00
Pipistrella	UTSW	15	66696135	missense	probably damaging	1.00
pluribus	UTSW	15	66715163	missense	probably damaging	0.98
samarai	UTSW	15	66758006	critical splice donor site	probably null
sariba	UTSW	15	66694870	missense	probably benign	0.01
ticker	UTSW	15	66827382	nonsense	probably null
Vampire	UTSW	15	66682827	missense	probably damaging	1.00
IGL03134:Tg	UTSW	15	66740718	missense	probably damaging	1.00
P0019:Tg	UTSW	15	66688863	missense	probably benign	0.01
R0121:Tg	UTSW	15	66740781	missense	probably benign	0.04
R0135:Tg	UTSW	15	66694870	missense	probably benign	0.01
R0227:Tg	UTSW	15	66698446	missense	possibly damaging	0.84
R0448:Tg	UTSW	15	66764442	missense	probably damaging	1.00
R0453:Tg	UTSW	15	66828533	missense	probably benign	0.09
R0504:Tg	UTSW	15	66682404	missense	probably damaging	0.97
R0543:Tg	UTSW	15	66729597	missense	probably benign	0.13
R0638:Tg	UTSW	15	66717208	missense	probably damaging	0.99
R0639:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0646:Tg	UTSW	15	66729626	missense	probably damaging	0.99
R0666:Tg	UTSW	15	66737521	missense	probably benign
R0673:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0689:Tg	UTSW	15	66839404	splice site	probably benign
R0704:Tg	UTSW	15	66757880	missense	probably benign	0.02
R0730:Tg	UTSW	15	66678789	missense	probably damaging	1.00
R0830:Tg	UTSW	15	66725144	missense	probably damaging	1.00
R0959:Tg	UTSW	15	66708010	missense	probably damaging	0.98
R1027:Tg	UTSW	15	66672409	missense	possibly damaging	0.65
R1061:Tg	UTSW	15	66698559	missense	probably benign	0.09
R1086:Tg	UTSW	15	66684062	missense	probably benign
R1103:Tg	UTSW	15	66719655	missense	probably benign	0.45
R1240:Tg	UTSW	15	66828548	missense	probably benign	0.16
R1281:Tg	UTSW	15	66696489	missense	probably benign	0.34
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1531:Tg	UTSW	15	66850502	missense	probably benign	0.02
R1544:Tg	UTSW	15	66705232	missense	probably benign	0.04
R1550:Tg	UTSW	15	66693430	missense	possibly damaging	0.52
R1575:Tg	UTSW	15	66729685	critical splice donor site	probably null
R1638:Tg	UTSW	15	66696166	nonsense	probably null
R1655:Tg	UTSW	15	66828568	critical splice donor site	probably null
R1671:Tg	UTSW	15	66692387	missense	possibly damaging	0.89
R1789:Tg	UTSW	15	66737548	missense	probably benign	0.00
R1883:Tg	UTSW	15	66671309	missense	probably damaging	1.00
R1984:Tg	UTSW	15	66682842	missense	probably benign
R2063:Tg	UTSW	15	66828553	missense	probably damaging	1.00
R2092:Tg	UTSW	15	66849607	missense	probably null	0.26
R2109:Tg	UTSW	15	66729594	missense	probably benign	0.02
R2128:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2129:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2207:Tg	UTSW	15	66681939	missense	probably benign	0.15
R2219:Tg	UTSW	15	66681933	missense	probably benign	0.03
R2228:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2229:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2259:Tg	UTSW	15	66683898	missense	probably benign
R2994:Tg	UTSW	15	66681953	missense	probably benign
R3904:Tg	UTSW	15	66766162	nonsense	probably null
R3946:Tg	UTSW	15	66674023	missense	probably damaging	1.00
R3965:Tg	UTSW	15	66684190	missense	probably benign
R4245:Tg	UTSW	15	66696469	missense	possibly damaging	0.68
R4451:Tg	UTSW	15	66766147	missense	probably benign	0.01
R4487:Tg	UTSW	15	66671396	missense	probably damaging	1.00
R4489:Tg	UTSW	15	66707942	missense	probably damaging	1.00
R4623:Tg	UTSW	15	66735271	missense	probably benign	0.23
R4659:Tg	UTSW	15	66673920	missense	possibly damaging	0.67
R4728:Tg	UTSW	15	66682827	missense	probably damaging	1.00
R4760:Tg	UTSW	15	66693319	missense	probably damaging	1.00
R4797:Tg	UTSW	15	66758006	critical splice donor site	probably null
R4944:Tg	UTSW	15	66764337	missense	probably damaging	1.00
R4998:Tg	UTSW	15	66674050	missense	probably damaging	1.00
R5009:Tg	UTSW	15	66696586	missense	probably benign	0.01
R5025:Tg	UTSW	15	66707930	missense	probably damaging	1.00
R5035:Tg	UTSW	15	66681813	splice site	probably null
R5049:Tg	UTSW	15	66827382	nonsense	probably null
R5073:Tg	UTSW	15	66735252	missense	probably benign	0.05
R5169:Tg	UTSW	15	66678780	nonsense	probably null
R5185:Tg	UTSW	15	66773474	missense	probably damaging	1.00
R5227:Tg	UTSW	15	66759567	missense	possibly damaging	0.87
R5300:Tg	UTSW	15	66678855	missense	probably damaging	1.00
R5334:Tg	UTSW	15	66678055	missense	probably damaging	1.00
R5339:Tg	UTSW	15	66678093	missense	probably damaging	1.00
R5402:Tg	UTSW	15	66739168	missense	probably damaging	0.98
R5441:Tg	UTSW	15	66696520	missense	possibly damaging	0.47
R5509:Tg	UTSW	15	66827293	missense	probably benign	0.45
R5580:Tg	UTSW	15	66685300	missense	possibly damaging	0.66
R5582:Tg	UTSW	15	66693435	missense	probably damaging	1.00
R5624:Tg	UTSW	15	66838057	missense	probably benign	0.11
R5686:Tg	UTSW	15	66688889	missense	probably benign	0.28
R6042:Tg	UTSW	15	66683993	missense	probably benign	0.01
R6122:Tg	UTSW	15	66828457	missense	probably damaging	1.00
R6146:Tg	UTSW	15	66673367	splice site	probably null
R6159:Tg	UTSW	15	66735247	missense	possibly damaging	0.71
R6223:Tg	UTSW	15	66707922	missense	probably benign	0.15
R6480:Tg	UTSW	15	66671311	missense	probably damaging	1.00
R6531:Tg	UTSW	15	66839362	missense	probably damaging	0.99
R6614:Tg	UTSW	15	66735259	missense	probably damaging	0.99
R6698:Tg	UTSW	15	66839362	missense	probably damaging	1.00
R6798:Tg	UTSW	15	66678839	missense	probably damaging	1.00
R6837:Tg	UTSW	15	66696135	missense	probably damaging	1.00
R6861:Tg	UTSW	15	66688891	missense	probably benign	0.00
R6888:Tg	UTSW	15	66696246	missense	probably damaging	0.99
R6933:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R6983:Tg	UTSW	15	66693358	missense	probably benign	0.01
R7078:Tg	UTSW	15	66673543	missense	probably damaging	1.00
R7244:Tg	UTSW	15	66740714	missense	probably damaging	1.00
R7320:Tg	UTSW	15	66694784	missense	possibly damaging	0.71
R7334:Tg	UTSW	15	66725272	missense	probably benign	0.01
R7418:Tg	UTSW	15	66696583	missense	probably damaging	0.99
R7485:Tg	UTSW	15	66696588	missense	probably benign	0.04
R7524:Tg	UTSW	15	66696161	missense	probably benign	0.01
R7529:Tg	UTSW	15	66694768	missense	probably damaging	0.99
R7540:Tg	UTSW	15	66689927	missense	probably benign	0.16
R7583:Tg	UTSW	15	66764418	missense	probably damaging	1.00
R7594:Tg	UTSW	15	66729583	missense	probably benign	0.20
R7667:Tg	UTSW	15	66715163	missense	probably damaging	0.98
R7722:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R7790:Tg	UTSW	15	66849604	missense	probably damaging	0.99
R7838:Tg	UTSW	15	66693263	missense	probably benign	0.00
R7890:Tg	UTSW	15	66683814	missense	probably damaging	1.00
R7904:Tg	UTSW	15	66705279	missense	probably benign	0.08
R7919:Tg	UTSW	15	66684074	missense	possibly damaging	0.73
R7921:Tg	UTSW	15	66683793	missense	probably benign	0.08
R8037:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8038:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8214:Tg	UTSW	15	66773398	missense	probably damaging	1.00
R8304:Tg	UTSW	15	66693260	nonsense	probably null
R8688:Tg	UTSW	15	66694953	critical splice donor site	probably benign
R8709:Tg	UTSW	15	66681937	missense	probably benign	0.08
R8714:Tg	UTSW	15	66684042	missense	probably damaging	0.97
R8901:Tg	UTSW	15	66685335	missense	probably damaging	1.00
R8917:Tg	UTSW	15	66773483	critical splice donor site	probably null
R9023:Tg	UTSW	15	66683673	missense	probably damaging	1.00
R9232:Tg	UTSW	15	66698461	missense	probably benign	0.01
R9310:Tg	UTSW	15	66827269	missense	possibly damaging	0.69
R9361:Tg	UTSW	15	66685397	missense	possibly damaging	0.50
R9389:Tg	UTSW	15	66689324	missense	probably benign	0.04
R9501:Tg	UTSW	15	66847074	missense	possibly damaging	0.52
R9510:Tg	UTSW	15	66674064	missense	probably damaging	1.00
R9594:Tg	UTSW	15	66735260	nonsense	probably null
R9629:Tg	UTSW	15	66683738	missense	possibly damaging	0.95
R9701:Tg	UTSW	15	66766142	missense	probably benign	0.03
R9743:Tg	UTSW	15	66689990	missense	probably benign	0.18
R9748:Tg	UTSW	15	66847159	missense	possibly damaging	0.91
T0975:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0005:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0065:Tg	UTSW	15	66682454	missense	probably damaging	1.00
X0067:Tg	UTSW	15	66748743	missense	probably benign	0.10
Z1177:Tg	UTSW	15	66685310	missense	possibly damaging	0.49
Z1177:Tg	UTSW	15	66849547	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGTGGCTCTGAGTCTAAGAC -3'
(R):5'- GCGCTTTCCTAACCACACAG -3'

Sequencing Primer
(F):5'- AGTCTAAGACTCTCTTTCTCTGTG -3'
(R):5'- TGGCCTTAATTCACCCAGGAGAATG -3'

Posted On

2018-06-22