Incidental Mutation 'R6505:Tg'
ID523798
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Namethyroglobulin
SynonymsTgn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location66670753-66850721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66759558 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 559 (A559T)
Ref Sequence ENSEMBL: ENSMUSP00000126454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495] [ENSMUST00000171045]
Predicted Effect probably damaging
Transcript: ENSMUST00000065916
AA Change: A2178T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: A2178T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163495
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171045
AA Change: A559T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: A559T

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172153
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
Also_ran UTSW 15 66678839 missense probably damaging 1.00
bedraggled UTSW 15 66740714 missense probably damaging 1.00
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
pipistrella UTSW 15 66696135 missense probably damaging 1.00
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
R7244:Tg UTSW 15 66740714 missense probably damaging 1.00
R7320:Tg UTSW 15 66694784 missense possibly damaging 0.71
R7334:Tg UTSW 15 66725272 missense probably benign 0.01
R7418:Tg UTSW 15 66696583 missense probably damaging 0.99
R7485:Tg UTSW 15 66696588 missense probably benign 0.04
R7524:Tg UTSW 15 66696161 missense probably benign 0.01
R7529:Tg UTSW 15 66694768 missense probably damaging 0.99
R7540:Tg UTSW 15 66689927 missense probably benign 0.16
R7583:Tg UTSW 15 66764418 missense probably damaging 1.00
R7594:Tg UTSW 15 66729583 missense probably benign 0.20
R7667:Tg UTSW 15 66715163 missense probably damaging 0.98
R7722:Tg UTSW 15 66764309 missense possibly damaging 0.73
R7790:Tg UTSW 15 66849604 missense probably damaging 0.99
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGTGGCTCTGAGTCTAAGAC -3'
(R):5'- GCGCTTTCCTAACCACACAG -3'

Sequencing Primer
(F):5'- AGTCTAAGACTCTCTTTCTCTGTG -3'
(R):5'- TGGCCTTAATTCACCCAGGAGAATG -3'
Posted On2018-06-22