Mutagenetix > Incidental Mutation

Incidental Mutation 'R6613:Pdzrn4'

523799

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R6613 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92677574 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 287 (I287T)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035399
AA Change: I48T

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: I48T

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169942
AA Change: I287T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: I287T

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229173

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.9%

Validation Efficiency

97% (37/38)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano2	G	A	6: 125,806,656		probably null	Het
Arfgef1	A	T	1: 10,194,396	I475N	possibly damaging	Het
Atg16l2	C	T	7: 101,290,581		probably null	Het
Atp2c2	T	G	8: 119,756,021	L874R	probably damaging	Het
C2cd3	T	A	7: 100,395,241	S343R	possibly damaging	Het
C4b	A	T	17: 34,733,565	S1167T	probably damaging	Het
Cacna1i	G	A	15: 80,321,259	G139S	probably damaging	Het
Chil6	A	T	3: 106,389,875	F317I	probably benign	Het
Cngb1	A	T	8: 95,266,010	V199E	possibly damaging	Het
Dcn	A	T	10: 97,495,040	T79S	probably benign	Het
Dcxr	A	G	11: 120,727,006	V48A	probably benign	Het
Dnajc13	A	T	9: 104,213,877	D668E	probably benign	Het
Dnajc28	C	A	16: 91,616,358	E357*	probably null	Het
Dock7	A	G	4: 98,977,960	Y1198H	probably damaging	Het
Flot1	A	G	17: 35,825,811	D167G	probably damaging	Het
Gpn1	T	C	5: 31,497,352		probably null	Het
Hyou1	A	T	9: 44,382,498	I242F	probably damaging	Het
Igfbpl1	T	C	4: 45,813,447	N256S	probably benign	Het
Kif20b	C	T	19: 34,936,984	Q390*	probably null	Het
Lhfpl2	T	A	13: 94,174,495	F91Y	probably damaging	Het
Magi1	G	A	6: 93,745,673	T408I	probably damaging	Het
Mttp	T	C	3: 138,109,078	N479D	probably damaging	Het
Myom3	T	C	4: 135,812,459	V1339A	possibly damaging	Het
Nin	T	C	12: 70,030,954	K1733E	probably damaging	Het
Olfr173	C	A	16: 58,797,531	C105F	probably damaging	Het
Ptprt	A	G	2: 161,530,447	V1435A	probably damaging	Het
Rpap3	T	C	15: 97,681,841		probably null	Het
Scin	A	G	12: 40,079,715	Y360H	probably benign	Het
Sfxn5	A	G	6: 85,269,908		probably null	Het
Sgo1	A	G	17: 53,679,057	S369P	probably damaging	Het
Skil	T	A	3: 31,097,880	C184S	probably null	Het
Srcin1	A	G	11: 97,533,827	M607T	possibly damaging	Het
Ssc5d	C	T	7: 4,933,293	P513S	possibly damaging	Het
Trip10	A	G	17: 57,255,197		probably null	Het
Vmn2r114	T	A	17: 23,310,246	Q294L	possibly damaging	Het
Zc3h12c	A	G	9: 52,116,112	V650A	possibly damaging	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGGCAACATTTTCTAATGCAGTGG -3'
(R):5'- AATGGACAGGTGTCAGGCAC -3'

Sequencing Primer
(F):5'- GCGTTTTGTTGATCAATTCCAGATAC -3'
(R):5'- CTGTACTTCCGGAGTCAT -3'

Posted On

2018-06-22