Incidental Mutation 'R6505:Ifnar1'
ID523804
Institutional Source Beutler Lab
Gene Symbol Ifnar1
Ensembl Gene ENSMUSG00000022967
Gene Nameinterferon (alpha and beta) receptor 1
SynonymsIfar, Ifrc, IFN-alpha/betaR
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010508; VEGA:  OTTMUST00000067225; MGI: 107658;

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location91485238-91507441 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 91499537 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 309 (Q309*)
Ref Sequence ENSEMBL: ENSMUSP00000112670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023689] [ENSMUST00000117748] [ENSMUST00000123196] [ENSMUST00000129878] [ENSMUST00000232509]
Predicted Effect probably null
Transcript: ENSMUST00000023689
AA Change: Q309*
SMART Domains Protein: ENSMUSP00000023689
Gene: ENSMUSG00000022967
AA Change: Q309*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117748
AA Change: Q309*
SMART Domains Protein: ENSMUSP00000112670
Gene: ENSMUSG00000022967
AA Change: Q309*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123196
SMART Domains Protein: ENSMUSP00000119160
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129878
SMART Domains Protein: ENSMUSP00000120945
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231604
Predicted Effect probably benign
Transcript: ENSMUST00000232509
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased susceptibility to viral infection, elevated levels of myeloid lineage cells in the peripheral blood and bone marrow, and reduced immune response to immunostimulatory DNA. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(5) Gene trapped(4) Chemically induced(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Ifnar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ifnar1 APN 16 91489782 missense probably damaging 0.99
IGL02183:Ifnar1 APN 16 91505146 missense possibly damaging 0.94
IGL02828:Ifnar1 APN 16 91505416 critical splice donor site probably null
macro-1 UTSW 16 91499885 missense probably damaging 0.98
shook UTSW 16 91499537 nonsense probably null
sneffels UTSW 16 91501620 critical splice acceptor site probably null
R0124:Ifnar1 UTSW 16 91499537 nonsense probably null
R0502:Ifnar1 UTSW 16 91501751 missense probably damaging 1.00
R0617:Ifnar1 UTSW 16 91501682 missense probably damaging 1.00
R1509:Ifnar1 UTSW 16 91503496 missense probably damaging 1.00
R4111:Ifnar1 UTSW 16 91496158 missense probably damaging 1.00
R4473:Ifnar1 UTSW 16 91495170 missense probably damaging 0.98
R4964:Ifnar1 UTSW 16 91505086 missense probably benign 0.08
R5497:Ifnar1 UTSW 16 91505364 missense probably benign 0.01
R6135:Ifnar1 UTSW 16 91501620 critical splice acceptor site probably null
R6398:Ifnar1 UTSW 16 91505415 critical splice donor site probably null
R6620:Ifnar1 UTSW 16 91496267 splice site probably null
R7229:Ifnar1 UTSW 16 91499556 missense probably benign 0.00
R7664:Ifnar1 UTSW 16 91495194 missense probably damaging 1.00
X0057:Ifnar1 UTSW 16 91495424 missense probably damaging 0.98
X0057:Ifnar1 UTSW 16 91505283 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGTCCACAGTGCTTACTACAGTGTC -3'
(R):5'- CGCCCTACATGAGGAATTACACTCC -3'

Posted On2018-06-22