Incidental Mutation 'R6505:Sncaip'
ID523819
Institutional Source Beutler Lab
Gene Symbol Sncaip
Ensembl Gene ENSMUSG00000024534
Gene Namesynuclein, alpha interacting protein (synphilin)
Synonymssynphilin-1, 4933427B05Rik, SYPH1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location52767709-52915935 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 52906537 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 189 (S189*)
Ref Sequence ENSEMBL: ENSMUSP00000137107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025413] [ENSMUST00000115410] [ENSMUST00000163742] [ENSMUST00000177861] [ENSMUST00000178011] [ENSMUST00000178678] [ENSMUST00000178883] [ENSMUST00000179625] [ENSMUST00000179689] [ENSMUST00000180259]
Predicted Effect probably null
Transcript: ENSMUST00000025413
AA Change: S601*
SMART Domains Protein: ENSMUSP00000025413
Gene: ENSMUSG00000024534
AA Change: S601*

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115410
AA Change: S601*
SMART Domains Protein: ENSMUSP00000111069
Gene: ENSMUSG00000024534
AA Change: S601*

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163742
AA Change: S601*
SMART Domains Protein: ENSMUSP00000127189
Gene: ENSMUSG00000024534
AA Change: S601*

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177861
Predicted Effect probably null
Transcript: ENSMUST00000178011
AA Change: S601*
SMART Domains Protein: ENSMUSP00000137549
Gene: ENSMUSG00000024534
AA Change: S601*

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178678
AA Change: S601*
SMART Domains Protein: ENSMUSP00000137367
Gene: ENSMUSG00000024534
AA Change: S601*

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
Pfam:SNCAIP_SNCA_bd 511 556 7.9e-30 PFAM
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178883
Predicted Effect probably null
Transcript: ENSMUST00000179625
AA Change: S541*
SMART Domains Protein: ENSMUSP00000136838
Gene: ENSMUSG00000024534
AA Change: S541*

DomainStartEndE-ValueType
ANK 358 387 5.03e2 SMART
ANK 395 424 4.26e-4 SMART
PDB:2KES|A 451 489 9e-10 PDB
low complexity region 490 511 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 809 815 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179689
AA Change: S189*
SMART Domains Protein: ENSMUSP00000137107
Gene: ENSMUSG00000024534
AA Change: S189*

DomainStartEndE-ValueType
ANK 43 72 4.26e-4 SMART
PDB:2KES|A 99 137 6e-10 PDB
low complexity region 138 159 N/A INTRINSIC
low complexity region 244 257 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 333 343 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 457 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180259
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing several protein-protein interaction domains, including ankyrin-like repeats, a coiled-coil domain, and an ATP/GTP-binding motif. The encoded protein interacts with alpha-synuclein in neuronal tissue and may play a role in the formation of cytoplasmic inclusions and neurodegeneration. A mutation in this gene has been associated with Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Sncaip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Sncaip APN 18 52884963 splice site probably null
IGL01554:Sncaip APN 18 52868934 missense possibly damaging 0.94
IGL01802:Sncaip APN 18 52869037 missense probably damaging 1.00
IGL02658:Sncaip APN 18 52894955 missense possibly damaging 0.50
IGL02737:Sncaip APN 18 52907056 missense probably benign 0.10
IGL03017:Sncaip APN 18 52894937 missense possibly damaging 0.82
PIT4445001:Sncaip UTSW 18 52868944 missense probably damaging 1.00
R0218:Sncaip UTSW 18 52907328 missense probably benign 0.18
R0325:Sncaip UTSW 18 52905809 missense probably damaging 1.00
R0450:Sncaip UTSW 18 52868709 missense probably benign 0.08
R0469:Sncaip UTSW 18 52868709 missense probably benign 0.08
R1494:Sncaip UTSW 18 52868886 missense probably damaging 0.99
R1897:Sncaip UTSW 18 52894790 splice site probably null
R1962:Sncaip UTSW 18 52871362 missense probably damaging 1.00
R2238:Sncaip UTSW 18 52868547 missense probably damaging 1.00
R2935:Sncaip UTSW 18 52838032 missense probably damaging 1.00
R4044:Sncaip UTSW 18 52907403 missense probably benign 0.01
R4694:Sncaip UTSW 18 52906557 missense probably benign 0.00
R4810:Sncaip UTSW 18 52907199 missense possibly damaging 0.47
R4850:Sncaip UTSW 18 52871384 missense probably damaging 1.00
R4857:Sncaip UTSW 18 52869225 missense probably benign 0.00
R4939:Sncaip UTSW 18 52907263 missense possibly damaging 0.53
R5384:Sncaip UTSW 18 52885041 missense probably damaging 1.00
R5610:Sncaip UTSW 18 52868919 missense probably benign
R5645:Sncaip UTSW 18 52894956 missense probably damaging 1.00
R5797:Sncaip UTSW 18 52898204 missense probably benign 0.28
R5977:Sncaip UTSW 18 52869321 missense probably benign
R6197:Sncaip UTSW 18 52906894 missense probably damaging 1.00
R6369:Sncaip UTSW 18 52868604 missense probably damaging 0.98
R6604:Sncaip UTSW 18 52905846 missense possibly damaging 0.71
R6880:Sncaip UTSW 18 52869064 missense probably damaging 1.00
R7215:Sncaip UTSW 18 52907343 nonsense probably null
R7234:Sncaip UTSW 18 52915344 missense probably benign 0.00
Z1177:Sncaip UTSW 18 52907425 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CATATCAAAGGCTATGCAAGGTC -3'
(R):5'- CTCAGTCTGGCTAGCTTCAG -3'

Sequencing Primer
(F):5'- TCAAAGGCTATGCAAGGTCTTATGG -3'
(R):5'- AGTCTGGCTAGCTTCAGTTCCC -3'
Posted On2018-06-22