Incidental Mutation 'R6505:Aldh7a1'
ID523821
Institutional Source Beutler Lab
Gene Symbol Aldh7a1
Ensembl Gene ENSMUSG00000053644
Gene Namealdehyde dehydrogenase family 7, member A1
SynonymsD18Wsu181e, Atq1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location56509687-56572951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56526996 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 498 (Y498C)
Ref Sequence ENSEMBL: ENSMUSP00000133372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066208] [ENSMUST00000172734] [ENSMUST00000174518] [ENSMUST00000174704]
Predicted Effect probably damaging
Transcript: ENSMUST00000066208
AA Change: Y526C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065089
Gene: ENSMUSG00000053644
AA Change: Y526C

DomainStartEndE-ValueType
Pfam:Aldedh 59 522 1.2e-130 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172734
AA Change: Y462C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134192
Gene: ENSMUSG00000053644
AA Change: Y462C

DomainStartEndE-ValueType
Pfam:Aldedh 59 340 6.3e-74 PFAM
Pfam:Aldedh 338 458 3.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172902
Predicted Effect probably damaging
Transcript: ENSMUST00000174518
AA Change: Y498C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133372
Gene: ENSMUSG00000053644
AA Change: Y498C

DomainStartEndE-ValueType
Pfam:Aldedh 31 494 7.3e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174704
SMART Domains Protein: ENSMUSP00000133970
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 57 293 1.4e-54 PFAM
Meta Mutation Damage Score 0.6063 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of subfamily 7 in the aldehyde dehydrogenase gene family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This particular member has homology to a previously described protein from the green garden pea, the 26g pea turgor protein. It is also involved in lysine catabolism that is known to occur in the mitochondrial matrix. Recent reports show that this protein is found both in the cytosol and the mitochondria, and the two forms likely arise from the use of alternative translation initiation sites. An additional variant encoding a different isoform has also been found for this gene. Mutations in this gene are associated with pyridoxine-dependent epilepsy. Several related pseudogenes have also been identified. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Aldh7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02690:Aldh7a1 APN 18 56528355 splice site probably benign
IGL02887:Aldh7a1 APN 18 56542216 intron probably benign
R0462:Aldh7a1 UTSW 18 56534214 splice site probably null
R0595:Aldh7a1 UTSW 18 56546893 splice site probably benign
R0657:Aldh7a1 UTSW 18 56537197 splice site probably benign
R0947:Aldh7a1 UTSW 18 56560838 splice site probably null
R1295:Aldh7a1 UTSW 18 56546950 critical splice acceptor site probably null
R1385:Aldh7a1 UTSW 18 56542285 missense probably damaging 1.00
R1403:Aldh7a1 UTSW 18 56559269 nonsense probably null
R1403:Aldh7a1 UTSW 18 56559269 nonsense probably null
R1517:Aldh7a1 UTSW 18 56532061 missense probably damaging 0.99
R1550:Aldh7a1 UTSW 18 56550382 missense possibly damaging 0.49
R3552:Aldh7a1 UTSW 18 56550292 splice site probably null
R3953:Aldh7a1 UTSW 18 56548505 missense probably damaging 0.99
R4124:Aldh7a1 UTSW 18 56537323 intron probably benign
R4296:Aldh7a1 UTSW 18 56544963 critical splice donor site probably null
R4355:Aldh7a1 UTSW 18 56548494 missense probably null 0.09
R4549:Aldh7a1 UTSW 18 56531994 missense probably benign 0.09
R4851:Aldh7a1 UTSW 18 56532016 missense possibly damaging 0.95
R5288:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5384:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5385:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5547:Aldh7a1 UTSW 18 56528284 missense probably damaging 1.00
R7373:Aldh7a1 UTSW 18 56542317 missense possibly damaging 0.48
R7861:Aldh7a1 UTSW 18 56548453 missense probably benign 0.03
R8205:Aldh7a1 UTSW 18 56544998 missense probably damaging 1.00
Z1177:Aldh7a1 UTSW 18 56526991 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCTGGGAATCACTGGAGATTAG -3'
(R):5'- TTCCGTTGTAAGGAATCGCACTG -3'

Sequencing Primer
(F):5'- CACTGGAGATTAGACACTGCTGTC -3'
(R):5'- GTTGGCTTTACCGACCTATAA -3'
Posted On2018-06-22