Incidental Mutation 'R6614:Adamts4'
ID523822
Institutional Source Beutler Lab
Gene Symbol Adamts4
Ensembl Gene ENSMUSG00000006403
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4
Synonymsaggrecanase-1, ADAM-TS4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location171250421-171260637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171256624 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 557 (R557G)
Ref Sequence ENSEMBL: ENSMUSP00000151387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111314] [ENSMUST00000111315] [ENSMUST00000219033]
Predicted Effect probably benign
Transcript: ENSMUST00000111314
AA Change: R360G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000106946
Gene: ENSMUSG00000006403
AA Change: R360G

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Reprolysin_5 27 214 1.8e-12 PFAM
Pfam:Reprolysin 29 239 1e-19 PFAM
Pfam:Reprolysin_4 33 235 1.2e-10 PFAM
Pfam:Reprolysin_3 50 183 5.4e-12 PFAM
Pfam:Reprolysin_2 50 229 1.9e-9 PFAM
Blast:ACR 240 319 4e-24 BLAST
TSP1 334 386 3.52e-14 SMART
Pfam:ADAM_spacer1 497 614 5.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111315
AA Change: R545G

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106947
Gene: ENSMUSG00000006403
AA Change: R545G

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Pep_M12B_propep 54 177 5.6e-17 PFAM
Pfam:Reprolysin_5 212 399 6.5e-12 PFAM
Pfam:Reprolysin 214 424 4.6e-19 PFAM
Pfam:Reprolysin_4 219 420 4.6e-10 PFAM
Pfam:Reprolysin_3 235 368 1.9e-11 PFAM
Pfam:Reprolysin_2 236 414 7.2e-9 PFAM
Blast:ACR 425 504 4e-24 BLAST
TSP1 519 571 3.52e-14 SMART
Pfam:ADAM_spacer1 682 799 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219033
AA Change: R557G

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active zinc-dependent aggrecanase enzyme that degrades cartilage. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological abnormalities. However, they do display impaired coordination and an increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Adamts4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Adamts4 APN 1 171252850 missense probably damaging 1.00
IGL02496:Adamts4 APN 1 171250943 missense probably benign 0.00
IGL02510:Adamts4 APN 1 171251390 missense probably benign 0.08
IGL02695:Adamts4 APN 1 171252634 missense probably damaging 1.00
IGL02952:Adamts4 APN 1 171251348 missense probably damaging 1.00
IGL03010:Adamts4 APN 1 171251416 missense probably damaging 1.00
IGL03304:Adamts4 APN 1 171252869 splice site probably benign
PIT4305001:Adamts4 UTSW 1 171259041 missense probably benign
R0331:Adamts4 UTSW 1 171250972 missense probably benign 0.00
R1302:Adamts4 UTSW 1 171253183 missense probably damaging 1.00
R1460:Adamts4 UTSW 1 171256440 splice site probably benign
R1502:Adamts4 UTSW 1 171258990 missense probably damaging 1.00
R1544:Adamts4 UTSW 1 171252742 missense probably benign 0.09
R1815:Adamts4 UTSW 1 171256336 missense probably damaging 0.99
R1982:Adamts4 UTSW 1 171258934 missense probably benign 0.00
R1986:Adamts4 UTSW 1 171256675 missense possibly damaging 0.94
R2281:Adamts4 UTSW 1 171256229 missense probably damaging 1.00
R4261:Adamts4 UTSW 1 171259104 missense probably benign 0.01
R4750:Adamts4 UTSW 1 171251066 missense probably benign
R4868:Adamts4 UTSW 1 171252431 intron probably benign
R4924:Adamts4 UTSW 1 171259074 missense probably damaging 0.97
R5418:Adamts4 UTSW 1 171252574 missense probably damaging 1.00
R5468:Adamts4 UTSW 1 171252609 missense probably benign
R5566:Adamts4 UTSW 1 171250850 start codon destroyed probably null 0.90
R5781:Adamts4 UTSW 1 171251015 missense possibly damaging 0.89
R6043:Adamts4 UTSW 1 171252601 missense probably damaging 1.00
R6053:Adamts4 UTSW 1 171252715 missense possibly damaging 0.85
R6187:Adamts4 UTSW 1 171250993 missense probably damaging 1.00
R6976:Adamts4 UTSW 1 171252308 intron probably benign
R7291:Adamts4 UTSW 1 171256528 missense probably benign
R7363:Adamts4 UTSW 1 171259039 missense probably benign 0.40
R7490:Adamts4 UTSW 1 171256600 nonsense probably null
R7797:Adamts4 UTSW 1 171257818 missense probably damaging 1.00
R8191:Adamts4 UTSW 1 171252723 missense
R8408:Adamts4 UTSW 1 171252745 missense possibly damaging 0.56
X0062:Adamts4 UTSW 1 171256549 missense probably damaging 1.00
Z1176:Adamts4 UTSW 1 171258783 missense probably benign 0.00
Z1176:Adamts4 UTSW 1 171258784 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTCAAGGACTTCAATGTGAGACC -3'
(R):5'- AATTTCCCCGGTAGAAGACAC -3'

Sequencing Primer
(F):5'- ACTTCAATGTGAGACCTCAGGGC -3'
(R):5'- TTTCCCCGGTAGAAGACACAATCC -3'
Posted On2018-06-22