Incidental Mutation 'R6578:Ankzf1'
ID523829
Institutional Source Beutler Lab
Gene Symbol Ankzf1
Ensembl Gene ENSMUSG00000026199
Gene Nameankyrin repeat and zinc finger domain containing 1
Synonyms2810025E10Rik, D1Ertd161e, 1300008P06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6578 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75192151-75199387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75197757 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 464 (R464G)
Ref Sequence ENSEMBL: ENSMUSP00000136163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113623] [ENSMUST00000127625] [ENSMUST00000145459] [ENSMUST00000152233] [ENSMUST00000155716] [ENSMUST00000185448]
Predicted Effect probably benign
Transcript: ENSMUST00000113623
SMART Domains Protein: ENSMUSP00000109253
Gene: ENSMUSG00000026200

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.1e-123 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127625
SMART Domains Protein: ENSMUSP00000137179
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 1e-10 BLAST
low complexity region 143 171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143193
Predicted Effect probably benign
Transcript: ENSMUST00000145459
SMART Domains Protein: ENSMUSP00000135971
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 1e-9 BLAST
low complexity region 143 171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151887
Predicted Effect possibly damaging
Transcript: ENSMUST00000152233
AA Change: R464G

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136163
Gene: ENSMUSG00000026199
AA Change: R464G

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 6e-11 BLAST
low complexity region 143 171 N/A INTRINSIC
low complexity region 394 407 N/A INTRINSIC
low complexity region 425 451 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
Blast:ANK 515 545 2e-9 BLAST
ANK 556 585 6.81e-3 SMART
coiled coil region 628 681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153584
Predicted Effect probably benign
Transcript: ENSMUST00000155716
SMART Domains Protein: ENSMUSP00000136285
Gene: ENSMUSG00000026200

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.2e-125 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185448
SMART Domains Protein: ENSMUSP00000140820
Gene: ENSMUSG00000026200

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 188 1.6e-71 PFAM
Pfam:Glyco_hydro_42 48 188 6.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186148
Predicted Effect probably benign
Transcript: ENSMUST00000186173
Predicted Effect probably benign
Transcript: ENSMUST00000189663
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Ankzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Ankzf1 APN 1 75192615 missense probably damaging 1.00
IGL02512:Ankzf1 APN 1 75192578 missense probably damaging 0.99
IGL02880:Ankzf1 APN 1 75192668 missense probably benign 0.18
R0207:Ankzf1 UTSW 1 75198304 missense possibly damaging 0.89
R1543:Ankzf1 UTSW 1 75192516 missense possibly damaging 0.59
R1663:Ankzf1 UTSW 1 75196270 missense probably damaging 1.00
R1853:Ankzf1 UTSW 1 75198128 splice site probably null
R2074:Ankzf1 UTSW 1 75196243 missense probably damaging 1.00
R2358:Ankzf1 UTSW 1 75195251 missense probably damaging 1.00
R4729:Ankzf1 UTSW 1 75194264 missense probably damaging 0.99
R5016:Ankzf1 UTSW 1 75195978 unclassified probably benign
R6159:Ankzf1 UTSW 1 75194244 missense probably damaging 1.00
R6226:Ankzf1 UTSW 1 75196594 missense probably benign 0.00
R7500:Ankzf1 UTSW 1 75197979 missense probably benign
RF016:Ankzf1 UTSW 1 75195833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGGAAGCACACATCTTTC -3'
(R):5'- CTGCAGCTTTAGCACCTCAAC -3'

Sequencing Primer
(F):5'- GAGGAAGCACACATCTTTCAACCC -3'
(R):5'- TTAGCACCTCAACTTCCCCAG -3'
Posted On2018-06-22