Incidental Mutation 'R6578:Gm7145'
ID523831
Institutional Source Beutler Lab
Gene Symbol Gm7145
Ensembl Gene ENSMUSG00000100617
Gene Namepredicted gene 7145
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R6578 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location117965939-117986884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117985795 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 136 (P136S)
Ref Sequence ENSEMBL: ENSMUSP00000140916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000185381]
Predicted Effect probably damaging
Transcript: ENSMUST00000185381
AA Change: P136S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140916
Gene: ENSMUSG00000100617
AA Change: P136S

DomainStartEndE-ValueType
KRAB 8 68 4.4e-36 SMART
ZnF_C2H2 109 131 3.6e-6 SMART
ZnF_C2H2 137 159 3.4e-5 SMART
ZnF_C2H2 165 187 1.7e-6 SMART
ZnF_C2H2 193 215 1e-7 SMART
ZnF_C2H2 221 243 2e-5 SMART
ZnF_C2H2 249 271 2.1e-7 SMART
ZnF_C2H2 277 299 9.3e-5 SMART
ZnF_C2H2 305 327 3.4e-4 SMART
ZnF_C2H2 333 355 3.2e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Gm7145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03027:Gm7145 APN 1 117967687 missense probably benign 0.00
R6133:Gm7145 UTSW 1 117985888 missense probably damaging 1.00
R6244:Gm7145 UTSW 1 117986140 missense probably damaging 1.00
R6381:Gm7145 UTSW 1 117985939 nonsense probably null
R6853:Gm7145 UTSW 1 117986144 missense possibly damaging 0.95
R6913:Gm7145 UTSW 1 117985981 missense probably damaging 1.00
R7159:Gm7145 UTSW 1 117985831 missense probably benign 0.01
R7196:Gm7145 UTSW 1 117986061 missense possibly damaging 0.81
R7313:Gm7145 UTSW 1 117986202 missense probably damaging 1.00
R7343:Gm7145 UTSW 1 117986112 missense probably damaging 1.00
R7369:Gm7145 UTSW 1 117986108 missense probably benign 0.01
R8034:Gm7145 UTSW 1 117986164 missense not run
Z1176:Gm7145 UTSW 1 117986351 missense not run
Predicted Primers PCR Primer
(F):5'- CAGATCAGGAAGCTCCAGATAC -3'
(R):5'- TTGTACCCAGTATGGATTCTCTG -3'

Sequencing Primer
(F):5'- GGAAGCTCCAGATACTCTTCCTGAG -3'
(R):5'- ACCCAGTATGGATTCTCTGGTGAAC -3'
Posted On2018-06-22