Incidental Mutation 'R6578:Aldh9a1'
ID523833
Institutional Source Beutler Lab
Gene Symbol Aldh9a1
Ensembl Gene ENSMUSG00000026687
Gene Namealdehyde dehydrogenase 9, subfamily A1
SynonymsESTM40, TMABA-DH
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6578 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location167349991-167368532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 167355759 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 182 (Y182C)
Ref Sequence ENSEMBL: ENSMUSP00000028004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028004]
Predicted Effect probably damaging
Transcript: ENSMUST00000028004
AA Change: Y182C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028004
Gene: ENSMUSG00000026687
AA Change: Y182C

DomainStartEndE-ValueType
Pfam:Aldedh 46 507 1.5e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194843
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. It has a high activity for oxidation of gamma-aminobutyraldehyde and other amino aldehydes. The enzyme catalyzes the dehydrogenation of gamma-aminobutyraldehyde to gamma-aminobutyric acid (GABA). This isozyme is a tetramer of identical 54-kD subunits. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Aldh9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Aldh9a1 APN 1 167364574 missense probably benign 0.21
IGL01432:Aldh9a1 APN 1 167355785 missense probably damaging 1.00
IGL02370:Aldh9a1 APN 1 167356532 missense probably damaging 1.00
Yummy UTSW 1 167352559 missense probably damaging 1.00
R0033:Aldh9a1 UTSW 1 167356571 missense probably damaging 0.99
R0197:Aldh9a1 UTSW 1 167361847 missense probably damaging 0.99
R0520:Aldh9a1 UTSW 1 167361391 splice site probably benign
R0836:Aldh9a1 UTSW 1 167350255 missense probably benign 0.03
R1224:Aldh9a1 UTSW 1 167352658 missense probably damaging 0.99
R1340:Aldh9a1 UTSW 1 167357344 missense probably benign 0.00
R1829:Aldh9a1 UTSW 1 167361854 missense probably benign 0.07
R2849:Aldh9a1 UTSW 1 167352628 missense probably damaging 0.98
R4937:Aldh9a1 UTSW 1 167361807 missense probably damaging 0.96
R4965:Aldh9a1 UTSW 1 167365789 missense probably damaging 1.00
R5065:Aldh9a1 UTSW 1 167352559 missense probably damaging 1.00
R7111:Aldh9a1 UTSW 1 167354452 missense probably benign 0.31
R7184:Aldh9a1 UTSW 1 167357396 missense probably benign 0.05
R7531:Aldh9a1 UTSW 1 167350326 missense probably benign
R7673:Aldh9a1 UTSW 1 167361550 missense probably benign 0.35
R8026:Aldh9a1 UTSW 1 167352667 critical splice donor site probably null
R8147:Aldh9a1 UTSW 1 167357380 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTAGACCTCAGGAGATTGTTTTG -3'
(R):5'- TTCCTTCAGGAGTGAGGCAGAG -3'

Sequencing Primer
(F):5'- TCCCCTGGAATTGGAACTACAGATG -3'
(R):5'- CAGAGCAGGGACAGGCC -3'
Posted On2018-06-22