Incidental Mutation 'R6614:Elavl1'
ID523834
Institutional Source Beutler Lab
Gene Symbol Elavl1
Ensembl Gene ENSMUSG00000040028
Gene NameELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R)
SynonymsW91709, 2410055N02Rik, Hua, HuR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location4285382-4325413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4289818 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 255 (A255S)
Ref Sequence ENSEMBL: ENSMUSP00000146866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098950] [ENSMUST00000209010]
Predicted Effect probably damaging
Transcript: ENSMUST00000098950
AA Change: A255S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096549
Gene: ENSMUSG00000040028
AA Change: A255S

DomainStartEndE-ValueType
RRM 21 94 1.3e-22 SMART
RRM 107 182 1.91e-20 SMART
RRM 245 318 6.15e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209010
AA Change: A255S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ELAVL family of RNA-binding proteins that contain several RNA recognition motifs, and selectively bind AU-rich elements (AREs) found in the 3' untranslated regions of mRNAs. AREs signal degradation of mRNAs as a means to regulate gene expression, thus by binding AREs, the ELAVL family of proteins play a role in stabilizing ARE-containing mRNAs. This gene has been implicated in a variety of biological processes and has been linked to a number of diseases, including cancer. It is highly expressed in many cancers, and could be potentially useful in cancer diagnosis, prognosis, and therapy. [provided by RefSeq, Sep 2012]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation and midgestational lethality due to placental failure resulting from extraembryonic trophoblast defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Elavl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Elavl1 APN 8 4301699 missense probably damaging 1.00
IGL02409:Elavl1 APN 8 4289838 missense possibly damaging 0.88
R0759:Elavl1 UTSW 8 4289815 missense probably damaging 1.00
R2322:Elavl1 UTSW 8 4289802 missense probably damaging 1.00
R4205:Elavl1 UTSW 8 4289851 missense probably damaging 0.99
R4946:Elavl1 UTSW 8 4301752 missense probably benign 0.05
R5009:Elavl1 UTSW 8 4301723 missense probably benign 0.00
R5073:Elavl1 UTSW 8 4301741 missense possibly damaging 0.79
R7200:Elavl1 UTSW 8 4311767 missense probably benign 0.00
R7204:Elavl1 UTSW 8 4311712 missense probably damaging 0.98
R7305:Elavl1 UTSW 8 4325199 unclassified probably benign
R7881:Elavl1 UTSW 8 4311763 missense probably damaging 1.00
R7903:Elavl1 UTSW 8 4301756 missense probably benign 0.28
R7964:Elavl1 UTSW 8 4311763 missense probably damaging 1.00
R7986:Elavl1 UTSW 8 4301756 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGAAACCTGTAAAATTTTGTCCCC -3'
(R):5'- AGGCCCAAGTGTCCTTACATC -3'

Sequencing Primer
(F):5'- GTAAAATTTTGTCCCCCAGGCGG -3'
(R):5'- AAGTGTCCTTACATCTTGGCC -3'
Posted On2018-06-22