Incidental Mutation 'R6614:2810004N23Rik'
ID523840
Institutional Source Beutler Lab
Gene Symbol 2810004N23Rik
Ensembl Gene ENSMUSG00000031984
Gene NameRIKEN cDNA 2810004N23 gene
SynonymsAyu21-55, Gt(Ayu21)55Imeg, GtAyu21-55
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124836945-124863120 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 124861247 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034465] [ENSMUST00000034466] [ENSMUST00000161986]
Predicted Effect probably benign
Transcript: ENSMUST00000034465
AA Change: Q38L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034465
Gene: ENSMUSG00000031984
AA Change: Q38L

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:DUF4602 119 243 1e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034466
SMART Domains Protein: ENSMUSP00000034466
Gene: ENSMUSG00000031985

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
SCOP:d1dbha1 27 146 6e-3 SMART
PlsC 155 284 8.3e-21 SMART
Blast:PlsC 308 336 1e-6 BLAST
low complexity region 638 652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161868
Predicted Effect probably null
Transcript: ENSMUST00000161986
SMART Domains Protein: ENSMUSP00000125323
Gene: ENSMUSG00000031985

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
PlsC 145 274 8.3e-21 SMART
Blast:PlsC 298 326 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212808
Meta Mutation Damage Score 0.0884 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in 2810004N23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:2810004N23Rik APN 8 124861191 missense probably benign 0.01
IGL03390:2810004N23Rik APN 8 124839825 utr 3 prime probably benign
FR4342:2810004N23Rik UTSW 8 124839833 frame shift probably null
R0519:2810004N23Rik UTSW 8 124839929 missense possibly damaging 0.90
R1302:2810004N23Rik UTSW 8 124839868 missense probably damaging 1.00
R1349:2810004N23Rik UTSW 8 124861253 missense possibly damaging 0.93
R1640:2810004N23Rik UTSW 8 124839845 missense probably damaging 1.00
R7150:2810004N23Rik UTSW 8 124862914 missense possibly damaging 0.81
R7806:2810004N23Rik UTSW 8 124842404 missense probably benign
RF061:2810004N23Rik UTSW 8 124839831 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGACAGGGACTTCTGAAGGG -3'
(R):5'- TGTATGCAGCTATCTGGGAAGG -3'

Sequencing Primer
(F):5'- ACTTCTGAAGGGGCAGCG -3'
(R):5'- GTGTGTCAACCCCGCCATATG -3'
Posted On2018-06-22