Incidental Mutation 'R6578:Spata16'
ID523841
Institutional Source Beutler Lab
Gene Symbol Spata16
Ensembl Gene ENSMUSG00000039335
Gene Namespermatogenesis associated 16
Synonymsspermatogenesis-related protein, 4921511F01Rik, 4930503K02Rik, Nyd-sp12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6578 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location26637620-26983212 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 26667548 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 73 (Q73*)
Ref Sequence ENSEMBL: ENSMUSP00000103941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047005] [ENSMUST00000108305]
Predicted Effect probably null
Transcript: ENSMUST00000047005
AA Change: Q73*
SMART Domains Protein: ENSMUSP00000043378
Gene: ENSMUSG00000039335
AA Change: Q73*

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 5 569 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108305
AA Change: Q73*
SMART Domains Protein: ENSMUSP00000103941
Gene: ENSMUSG00000039335
AA Change: Q73*

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 1 534 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a testis-specific protein that belongs to the tetratricopeptide repeat-like superfamily. The encoded protein localizes to the Golgi apparatus and may play a role in spermatogenesis. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Spata16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Spata16 APN 3 26924262 missense probably damaging 0.98
IGL01017:Spata16 APN 3 26840722 missense possibly damaging 0.93
IGL01129:Spata16 APN 3 26913184 splice site probably benign
IGL01330:Spata16 APN 3 26914715 missense probably damaging 0.99
IGL02033:Spata16 APN 3 26913334 critical splice donor site probably null
IGL02069:Spata16 APN 3 26732795 nonsense probably null
IGL02231:Spata16 APN 3 26913264 missense probably damaging 1.00
R0084:Spata16 UTSW 3 26667410 missense possibly damaging 0.95
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0325:Spata16 UTSW 3 26667456 missense probably damaging 0.98
R0811:Spata16 UTSW 3 26913338 splice site probably benign
R2061:Spata16 UTSW 3 26924370 missense probably damaging 0.99
R3148:Spata16 UTSW 3 26878712 critical splice donor site probably null
R4837:Spata16 UTSW 3 26732932 missense possibly damaging 0.93
R4972:Spata16 UTSW 3 26840723 missense possibly damaging 0.93
R5129:Spata16 UTSW 3 26667564 missense probably damaging 0.98
R5235:Spata16 UTSW 3 26667632 missense probably benign 0.00
R5458:Spata16 UTSW 3 26777537 missense probably damaging 0.99
R7069:Spata16 UTSW 3 26927334 missense probably damaging 0.99
R7256:Spata16 UTSW 3 26667867 missense probably benign 0.25
R8015:Spata16 UTSW 3 26667659 missense probably benign
R8060:Spata16 UTSW 3 26840720 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGGGTGGACCAATGGATTC -3'
(R):5'- ATAGACCAGCTTCATTTCCACATC -3'

Sequencing Primer
(F):5'- TGGACCAATGGATTCTGGCAAG -3'
(R):5'- CATCCATTATGTTCTTTAAGGGGATG -3'
Posted On2018-06-22