Incidental Mutation 'R6614:Filip1'
ID523844
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Namefilamin A interacting protein 1
Synonyms5730485H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.527) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location79815051-80012851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79815839 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1166 (G1166D)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
Predicted Effect probably damaging
Transcript: ENSMUST00000093811
AA Change: G1166D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: G1166D

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172740
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79817944 missense probably damaging 1.00
IGL01101:Filip1 APN 9 79898246 missense probably benign 0.44
IGL01301:Filip1 APN 9 79819180 missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79819617 missense probably benign 0.42
IGL02119:Filip1 APN 9 79818266 missense probably benign
IGL02285:Filip1 APN 9 79820126 missense probably damaging 1.00
IGL02395:Filip1 APN 9 79898410 missense probably benign 0.01
IGL03398:Filip1 APN 9 79818943 missense probably benign 0.03
IGL03400:Filip1 APN 9 79820473 missense probably benign 0.01
IGL03404:Filip1 APN 9 79818559 missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79819180 missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79819528 missense probably benign 0.04
R0243:Filip1 UTSW 9 79819003 missense probably damaging 0.98
R0244:Filip1 UTSW 9 79819462 missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79860091 missense probably damaging 1.00
R0399:Filip1 UTSW 9 79818310 missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79820289 missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79819390 missense probably damaging 1.00
R1314:Filip1 UTSW 9 79820566 missense probably damaging 1.00
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1602:Filip1 UTSW 9 79820591 missense probably damaging 0.99
R1801:Filip1 UTSW 9 79815846 missense probably damaging 0.98
R1929:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R1983:Filip1 UTSW 9 79860092 missense probably damaging 1.00
R2066:Filip1 UTSW 9 79820216 missense probably damaging 1.00
R2128:Filip1 UTSW 9 79819330 missense probably damaging 0.99
R2271:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2411:Filip1 UTSW 9 79898433 missense probably damaging 0.98
R3429:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3430:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3945:Filip1 UTSW 9 79818367 missense probably benign 0.01
R4007:Filip1 UTSW 9 79818727 missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79815809 missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79820114 missense probably benign 0.05
R4837:Filip1 UTSW 9 79819459 missense probably damaging 0.98
R4910:Filip1 UTSW 9 79817932 missense probably benign 0.00
R4929:Filip1 UTSW 9 79819747 missense probably benign 0.07
R5387:Filip1 UTSW 9 79818274 missense probably benign
R5581:Filip1 UTSW 9 79819760 missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79818701 missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79819860 missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79819454 missense probably damaging 0.99
R6273:Filip1 UTSW 9 79815886 missense probably benign 0.01
R6380:Filip1 UTSW 9 79819624 missense probably damaging 0.99
R6385:Filip1 UTSW 9 79820531 missense possibly damaging 0.68
R6715:Filip1 UTSW 9 79818758 missense probably benign 0.03
R7047:Filip1 UTSW 9 79853634 missense probably damaging 0.98
R7126:Filip1 UTSW 9 79898295 missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79820213 missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79818074 missense probably benign
R7404:Filip1 UTSW 9 79820098 missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79820649 missense probably benign 0.20
R7866:Filip1 UTSW 9 79818943 missense probably benign 0.03
R7933:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79817959 missense probably damaging 0.97
R8097:Filip1 UTSW 9 79818259 missense probably benign
R8213:Filip1 UTSW 9 79818092 missense probably benign 0.01
R8305:Filip1 UTSW 9 79820475 nonsense probably null
X0054:Filip1 UTSW 9 79819535 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTTCCACAGCAGCAGTAGC -3'
(R):5'- AGACTGCGGCTTTCTCAACC -3'

Sequencing Primer
(F):5'- AGCAGCAGTAGCATCCTTAC -3'
(R):5'- ACCCTTTTCCCTAGGATGGGTTG -3'
Posted On2018-06-22