Incidental Mutation 'R6578:Skint8'
ID523845
Institutional Source Beutler Lab
Gene Symbol Skint8
Ensembl Gene ENSMUSG00000078599
Gene Nameselection and upkeep of intraepithelial T cells 8
SynonymsOTTMUSG00000009475
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R6578 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location111919392-111950358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111936962 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 183 (T183I)
Ref Sequence ENSEMBL: ENSMUSP00000133268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106572] [ENSMUST00000165046]
Predicted Effect probably benign
Transcript: ENSMUST00000106572
AA Change: T183I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102182
Gene: ENSMUSG00000078599
AA Change: T183I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 3.13e-5 SMART
Blast:IG_like 148 231 9e-16 BLAST
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124862
Predicted Effect probably benign
Transcript: ENSMUST00000165046
AA Change: T183I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133268
Gene: ENSMUSG00000078599
AA Change: T183I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 3.13e-5 SMART
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 352 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Skint8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Skint8 APN 4 111938923 missense probably benign 0.05
IGL01411:Skint8 APN 4 111936906 missense probably damaging 0.97
IGL02973:Skint8 APN 4 111939593 missense probably benign 0.09
IGL03154:Skint8 APN 4 111939510 splice site probably null
FR4976:Skint8 UTSW 4 111938902 missense probably benign 0.02
R0309:Skint8 UTSW 4 111938867 missense probably benign 0.02
R0448:Skint8 UTSW 4 111936890 missense probably damaging 1.00
R0483:Skint8 UTSW 4 111938823 splice site probably benign
R0586:Skint8 UTSW 4 111936929 missense probably damaging 1.00
R1076:Skint8 UTSW 4 111927219 missense probably damaging 1.00
R1169:Skint8 UTSW 4 111928513 missense possibly damaging 0.86
R1588:Skint8 UTSW 4 111928727 nonsense probably null
R1707:Skint8 UTSW 4 111939572 missense probably damaging 1.00
R1865:Skint8 UTSW 4 111936995 missense probably damaging 1.00
R1954:Skint8 UTSW 4 111950081 missense possibly damaging 0.54
R2147:Skint8 UTSW 4 111937077 missense probably damaging 1.00
R2896:Skint8 UTSW 4 111950136 missense probably null
R4945:Skint8 UTSW 4 111939608 missense probably damaging 0.96
R5019:Skint8 UTSW 4 111928648 missense probably damaging 0.99
R5281:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5284:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5289:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5309:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5310:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5588:Skint8 UTSW 4 111936892 missense probably benign 0.01
R5636:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5637:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5638:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5639:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5719:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5720:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5754:Skint8 UTSW 4 111950190 missense probably benign
R5850:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5855:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R6036:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R6525:Skint8 UTSW 4 111928738 missense probably damaging 0.98
R6554:Skint8 UTSW 4 111927216 missense probably benign 0.35
R6841:Skint8 UTSW 4 111928771 missense probably damaging 1.00
R7000:Skint8 UTSW 4 111937025 missense probably benign 0.16
R7317:Skint8 UTSW 4 111939520 missense possibly damaging 0.94
R7336:Skint8 UTSW 4 111939572 missense probably benign 0.32
R7412:Skint8 UTSW 4 111928561 missense probably benign 0.07
R7480:Skint8 UTSW 4 111928587 nonsense probably null
R8027:Skint8 UTSW 4 111928739 missense probably benign 0.36
R8204:Skint8 UTSW 4 111938893 missense probably benign 0.03
Z1177:Skint8 UTSW 4 111937054 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CATCAACTGCCAAATGGTTACTC -3'
(R):5'- AGATGACAGTACTCACTTGCTAG -3'

Sequencing Primer
(F):5'- ACTGCCAAATGGTTACTCTAAATTG -3'
(R):5'- CAGTACTCACTTGCTAGAATGATAC -3'
Posted On2018-06-22