Incidental Mutation 'R6614:Olfr57'
ID523846
Institutional Source Beutler Lab
Gene Symbol Olfr57
Ensembl Gene ENSMUSG00000060205
Gene Nameolfactory receptor 57
SynonymsGA_x6K02T2QGN0-2777431-2776472, IF12, MOR139-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79028741-79036274 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 79035091 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 98 (C98*)
Ref Sequence ENSEMBL: ENSMUSP00000144814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082244] [ENSMUST00000203906]
Predicted Effect probably null
Transcript: ENSMUST00000082244
AA Change: C98*
SMART Domains Protein: ENSMUSP00000080872
Gene: ENSMUSG00000060205
AA Change: C98*

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.2e-49 PFAM
Pfam:7tm_1 42 291 6e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203906
AA Change: C98*
SMART Domains Protein: ENSMUSP00000144814
Gene: ENSMUSG00000060205
AA Change: C98*

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:7tm_4 32 308 2e-49 PFAM
Pfam:7tm_1 42 291 1.9e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Olfr57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr57 APN 10 79035611 missense probably benign 0.05
IGL02230:Olfr57 APN 10 79035042 missense probably damaging 0.99
IGL02283:Olfr57 APN 10 79035545 missense probably damaging 1.00
IGL02878:Olfr57 APN 10 79035558 missense probably benign 0.23
IGL02975:Olfr57 APN 10 79035033 missense possibly damaging 0.83
IGL03259:Olfr57 APN 10 79035400 nonsense probably null
R1366:Olfr57 UTSW 10 79035042 missense probably damaging 1.00
R1438:Olfr57 UTSW 10 79035288 missense possibly damaging 0.88
R1528:Olfr57 UTSW 10 79035564 missense probably damaging 0.96
R1601:Olfr57 UTSW 10 79035504 missense possibly damaging 0.56
R2032:Olfr57 UTSW 10 79035329 missense possibly damaging 0.86
R2112:Olfr57 UTSW 10 79035414 missense probably damaging 1.00
R2382:Olfr57 UTSW 10 79035134 missense possibly damaging 0.52
R2967:Olfr57 UTSW 10 79035053 missense probably damaging 1.00
R3773:Olfr57 UTSW 10 79035180 missense possibly damaging 0.95
R3940:Olfr57 UTSW 10 79035204 missense probably damaging 1.00
R4405:Olfr57 UTSW 10 79035410 missense probably benign
R5944:Olfr57 UTSW 10 79035389 missense probably benign 0.00
R6563:Olfr57 UTSW 10 79035217 missense possibly damaging 0.67
R7181:Olfr57 UTSW 10 79035453 missense probably damaging 0.98
R7639:Olfr57 UTSW 10 79035372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTTCACTGGAAACCTACTCATC -3'
(R):5'- TTGTGCAGAATGACAGCCG -3'

Sequencing Primer
(F):5'- TGGAAACCTACTCATCATCATGG -3'
(R):5'- GTGCAGAATGACAGCCGTAACAC -3'
Posted On2018-06-22