Mutagenetix > Incidental Mutation

Incidental Mutation 'R6578:Phf14'

523851

Institutional Source

Beutler Lab

Gene Symbol

Phf14

Ensembl Gene

ENSMUSG00000029629

Gene Name

PHD finger protein 14

Synonyms

5730446A07Rik, 4932409F11Rik, 1110001C23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6578 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11907809-12081205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 11991997 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 724 (C724Y)

Ref Sequence

ENSEMBL: ENSMUSP00000111172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090632] [ENSMUST00000115510] [ENSMUST00000115511]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090632
AA Change: C724Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088126
Gene: ENSMUSG00000029629
AA Change: C724Y

Domain	Start	End	E-Value	Type
low complexity region	34	48	N/A	INTRINSIC
coiled coil region	61	89	N/A	INTRINSIC
low complexity region	97	130	N/A	INTRINSIC
low complexity region	131	166	N/A	INTRINSIC
low complexity region	223	251	N/A	INTRINSIC
PHD	314	371	1.64e-9	SMART
PHD	433	492	1.18e-6	SMART
coiled coil region	620	671	N/A	INTRINSIC
PHD	720	770	9.54e-11	SMART
low complexity region	830	848	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115510
AA Change: C724Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111172
Gene: ENSMUSG00000029629
AA Change: C724Y

Domain	Start	End	E-Value	Type
low complexity region	34	48	N/A	INTRINSIC
coiled coil region	61	89	N/A	INTRINSIC
low complexity region	97	130	N/A	INTRINSIC
low complexity region	131	166	N/A	INTRINSIC
low complexity region	223	251	N/A	INTRINSIC
PHD	314	371	1.64e-9	SMART
PHD	433	492	1.18e-6	SMART
coiled coil region	620	671	N/A	INTRINSIC
PHD	720	770	9.54e-11	SMART
low complexity region	830	848	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115511
AA Change: C724Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111173
Gene: ENSMUSG00000029629
AA Change: C724Y

Domain	Start	End	E-Value	Type
low complexity region	34	48	N/A	INTRINSIC
coiled coil region	61	89	N/A	INTRINSIC
low complexity region	97	130	N/A	INTRINSIC
low complexity region	131	166	N/A	INTRINSIC
low complexity region	223	251	N/A	INTRINSIC
PHD	314	371	1.64e-9	SMART
RING	315	381	1.21e1	SMART
PHD	433	492	1.18e-6	SMART
coiled coil region	620	671	N/A	INTRINSIC
PHD	720	770	9.54e-11	SMART
RING	721	769	2.63e0	SMART
low complexity region	830	848	N/A	INTRINSIC
PHD	863	912	9.92e-9	SMART
RING	864	911	3.17e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204565

Meta Mutation Damage Score

0.9421

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 96.8%
20x: 89.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality due to respiratory failure, pulmonary wall hypertrophy, abnormal sternum ossification, and increased proliferation of bone marrow-derived mesenchymal cells and mouse embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	G	A	6: 146,953,314	R77*	probably null	Het
Aldh9a1	A	G	1: 167,355,759	Y182C	probably damaging	Het
Alpk3	T	A	7: 81,078,684	S521T	probably benign	Het
Ankzf1	A	G	1: 75,197,757	R464G	possibly damaging	Het
Baz2b	T	C	2: 59,969,279	E232G	possibly damaging	Het
Bbs2	T	C	8: 94,077,041	S524G	probably null	Het
Casp1	A	G	9: 5,304,280	K318R	probably benign	Het
Clock	T	A	5: 76,216,709	Q853L	unknown	Het
Clstn3	A	G	6: 124,450,704		probably null	Het
Ebpl	A	C	14: 61,360,320	V24G	probably benign	Het
Erbb2	T	C	11: 98,428,188	C568R	probably damaging	Het
Gcm2	A	G	13: 41,105,678	I105T	probably damaging	Het
Gm7145	C	T	1: 117,985,795	P136S	probably damaging	Het
Helb	G	T	10: 120,111,181	R76S	probably damaging	Het
Hipk4	T	C	7: 27,528,387	I186T	probably damaging	Het
Igdcc3	A	G	9: 65,182,019	D499G	probably damaging	Het
Krt26	T	A	11: 99,334,802	Q284H	probably damaging	Het
Lama4	T	C	10: 39,017,365	I156T	probably benign	Het
Mical2	T	A	7: 112,311,445	F274Y	probably damaging	Het
Mug1	A	T	6: 121,887,452	Q1436L	probably benign	Het
Nin	A	G	12: 70,061,194	V208A	probably damaging	Het
Olfr1181	T	C	2: 88,423,144	S294G	probably benign	Het
Pappa	T	A	4: 65,156,137	N309K	possibly damaging	Het
Pdcd11	T	C	19: 47,111,081	V873A	probably benign	Het
Pik3r2	T	G	8: 70,772,639	I127L	probably benign	Het
Polr1a	T	A	6: 71,976,041	M1531K	possibly damaging	Het
Pwwp2b	T	C	7: 139,256,112	C490R	probably damaging	Het
Rax	T	C	18: 65,938,667	T50A	probably benign	Het
Rbm28	A	T	6: 29,137,640	I438N	probably damaging	Het
Sema4c	C	T	1: 36,550,753	V507I	probably benign	Het
Skint8	C	T	4: 111,936,962	T183I	probably benign	Het
Spata16	C	T	3: 26,667,548	Q73*	probably null	Het
Sync	T	C	4: 129,294,267	L364P	probably damaging	Het
Syne1	T	A	10: 5,405,454	K376*	probably null	Het
Tanc1	C	T	2: 59,795,954	R552C	probably damaging	Het
Tdrd6	T	C	17: 43,628,961	I399V	possibly damaging	Het
Vps13b	T	C	15: 35,446,101	C455R	probably damaging	Het

Other mutations in Phf14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Phf14	APN	6	11941424	splice site	probably benign
IGL01120:Phf14	APN	6	11962740	missense	probably damaging	1.00
IGL01575:Phf14	APN	6	11990051	missense	probably damaging	1.00
IGL02153:Phf14	APN	6	11934016	missense	probably damaging	0.99
IGL02735:Phf14	APN	6	11987612	missense	probably benign	0.21
IGL03294:Phf14	APN	6	11953367	missense	probably damaging	1.00
IGL03392:Phf14	APN	6	11962659	missense	probably damaging	1.00
G1Funyon:Phf14	UTSW	6	11992062	missense	probably damaging	0.97
R0060:Phf14	UTSW	6	11953317	missense	probably damaging	0.97
R0099:Phf14	UTSW	6	11987697	unclassified	probably benign
R0384:Phf14	UTSW	6	11997020	splice site	probably benign
R0433:Phf14	UTSW	6	11933743	missense	probably damaging	1.00
R0563:Phf14	UTSW	6	11933601	intron	probably benign
R0590:Phf14	UTSW	6	11961578	missense	possibly damaging	0.72
R1066:Phf14	UTSW	6	11987255	missense	possibly damaging	0.47
R1187:Phf14	UTSW	6	11941496	missense	probably damaging	0.97
R1469:Phf14	UTSW	6	11933727	missense	possibly damaging	0.66
R1469:Phf14	UTSW	6	11933727	missense	possibly damaging	0.66
R1491:Phf14	UTSW	6	11941479	missense	possibly damaging	0.80
R1543:Phf14	UTSW	6	11987683	critical splice donor site	probably null
R1595:Phf14	UTSW	6	11988753	missense	possibly damaging	0.69
R1861:Phf14	UTSW	6	11987611	missense	probably benign	0.00
R2289:Phf14	UTSW	6	12047846	missense	probably damaging	1.00
R2437:Phf14	UTSW	6	11962658	missense	probably damaging	1.00
R3831:Phf14	UTSW	6	11933874	splice site	probably null
R3832:Phf14	UTSW	6	11933874	splice site	probably null
R3833:Phf14	UTSW	6	11933874	splice site	probably null
R4290:Phf14	UTSW	6	11987097	missense	probably damaging	1.00
R4293:Phf14	UTSW	6	11987097	missense	probably damaging	1.00
R4294:Phf14	UTSW	6	11987097	missense	probably damaging	1.00
R4295:Phf14	UTSW	6	11987097	missense	probably damaging	1.00
R4572:Phf14	UTSW	6	12006824	missense	probably damaging	1.00
R4663:Phf14	UTSW	6	11953422	missense	possibly damaging	0.92
R4673:Phf14	UTSW	6	11992057	missense	probably damaging	1.00
R4882:Phf14	UTSW	6	11988757	missense	possibly damaging	0.88
R4954:Phf14	UTSW	6	11987620	missense	probably benign	0.09
R5148:Phf14	UTSW	6	11961642	missense	possibly damaging	0.72
R5284:Phf14	UTSW	6	11997120	missense	probably damaging	0.99
R5569:Phf14	UTSW	6	11934016	missense	probably damaging	0.99
R5694:Phf14	UTSW	6	11990125	missense	possibly damaging	0.68
R5726:Phf14	UTSW	6	11933538	intron	probably benign
R5730:Phf14	UTSW	6	11953320	missense	possibly damaging	0.54
R5819:Phf14	UTSW	6	11997252	splice site	probably null
R5915:Phf14	UTSW	6	11933727	missense	possibly damaging	0.66
R6950:Phf14	UTSW	6	12006855	missense	probably damaging	1.00
R7181:Phf14	UTSW	6	11933341	missense	unknown
R7352:Phf14	UTSW	6	11961638	missense	probably damaging	1.00
R7355:Phf14	UTSW	6	12081007	missense	probably benign	0.01
R7947:Phf14	UTSW	6	11933307	missense	unknown
R8110:Phf14	UTSW	6	11953423	missense	possibly damaging	0.91
R8283:Phf14	UTSW	6	11987637	missense	probably benign	0.20
R8301:Phf14	UTSW	6	11992062	missense	probably damaging	0.97
R8688:Phf14	UTSW	6	11990035	missense	probably damaging	0.98
R9343:Phf14	UTSW	6	11961564	missense	probably damaging	1.00
R9402:Phf14	UTSW	6	11933780	missense	possibly damaging	0.49
R9434:Phf14	UTSW	6	11933493	missense	unknown
X0025:Phf14	UTSW	6	11926813	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGATGGGTGCCATTAAAAGC -3'
(R):5'- GCACAGAAAGCTCTTGTACCTTATG -3'

Sequencing Primer
(F):5'- AGTACTTCAGAGTCCTCTAGCAC -3'
(R):5'- GGTTGTACTGTTGAGGCTAAAAAC -3'

Posted On

2018-06-22