Incidental Mutation 'R6578:Phf14'
ID523851
Institutional Source Beutler Lab
Gene Symbol Phf14
Ensembl Gene ENSMUSG00000029629
Gene NamePHD finger protein 14
Synonyms5730446A07Rik, 4932409F11Rik, 1110001C23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6578 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location11907809-12081205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11991997 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 724 (C724Y)
Ref Sequence ENSEMBL: ENSMUSP00000111172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090632] [ENSMUST00000115510] [ENSMUST00000115511]
Predicted Effect probably damaging
Transcript: ENSMUST00000090632
AA Change: C724Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088126
Gene: ENSMUSG00000029629
AA Change: C724Y

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115510
AA Change: C724Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111172
Gene: ENSMUSG00000029629
AA Change: C724Y

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115511
AA Change: C724Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111173
Gene: ENSMUSG00000029629
AA Change: C724Y

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
RING 315 381 1.21e1 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
RING 721 769 2.63e0 SMART
low complexity region 830 848 N/A INTRINSIC
PHD 863 912 9.92e-9 SMART
RING 864 911 3.17e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204565
Meta Mutation Damage Score 0.9421 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality due to respiratory failure, pulmonary wall hypertrophy, abnormal sternum ossification, and increased proliferation of bone marrow-derived mesenchymal cells and mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Phf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Phf14 APN 6 11941424 splice site probably benign
IGL01120:Phf14 APN 6 11962740 missense probably damaging 1.00
IGL01575:Phf14 APN 6 11990051 missense probably damaging 1.00
IGL02153:Phf14 APN 6 11934016 missense probably damaging 0.99
IGL02735:Phf14 APN 6 11987612 missense probably benign 0.21
IGL03294:Phf14 APN 6 11953367 missense probably damaging 1.00
IGL03392:Phf14 APN 6 11962659 missense probably damaging 1.00
R0060:Phf14 UTSW 6 11953317 missense probably damaging 0.97
R0099:Phf14 UTSW 6 11987697 unclassified probably benign
R0384:Phf14 UTSW 6 11997020 splice site probably benign
R0433:Phf14 UTSW 6 11933743 missense probably damaging 1.00
R0563:Phf14 UTSW 6 11933601 intron probably benign
R0590:Phf14 UTSW 6 11961578 missense possibly damaging 0.72
R1066:Phf14 UTSW 6 11987255 missense possibly damaging 0.47
R1187:Phf14 UTSW 6 11941496 missense probably damaging 0.97
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1491:Phf14 UTSW 6 11941479 missense possibly damaging 0.80
R1543:Phf14 UTSW 6 11987683 critical splice donor site probably null
R1595:Phf14 UTSW 6 11988753 missense possibly damaging 0.69
R1861:Phf14 UTSW 6 11987611 missense probably benign 0.00
R2289:Phf14 UTSW 6 12047846 missense probably damaging 1.00
R2437:Phf14 UTSW 6 11962658 missense probably damaging 1.00
R3831:Phf14 UTSW 6 11933874 unclassified probably null
R3832:Phf14 UTSW 6 11933874 unclassified probably null
R3833:Phf14 UTSW 6 11933874 unclassified probably null
R4290:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4293:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4294:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4295:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4572:Phf14 UTSW 6 12006824 missense probably damaging 1.00
R4663:Phf14 UTSW 6 11953422 missense possibly damaging 0.92
R4673:Phf14 UTSW 6 11992057 missense probably damaging 1.00
R4882:Phf14 UTSW 6 11988757 missense possibly damaging 0.88
R4954:Phf14 UTSW 6 11987620 missense probably benign 0.09
R5148:Phf14 UTSW 6 11961642 missense possibly damaging 0.72
R5284:Phf14 UTSW 6 11997120 missense probably damaging 0.99
R5569:Phf14 UTSW 6 11934016 missense probably damaging 0.99
R5694:Phf14 UTSW 6 11990125 missense possibly damaging 0.68
R5726:Phf14 UTSW 6 11933538 intron probably benign
R5730:Phf14 UTSW 6 11953320 missense possibly damaging 0.54
R5819:Phf14 UTSW 6 11997252 intron probably null
R5915:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R6950:Phf14 UTSW 6 12006855 missense probably damaging 1.00
R7181:Phf14 UTSW 6 11933341 missense unknown
R7352:Phf14 UTSW 6 11961638 missense probably damaging 1.00
R7355:Phf14 UTSW 6 12081007 missense probably benign 0.01
R8110:Phf14 UTSW 6 11953423 missense possibly damaging 0.91
R8283:Phf14 UTSW 6 11987637 missense probably benign 0.20
R8301:Phf14 UTSW 6 11992062 missense probably damaging 0.97
X0025:Phf14 UTSW 6 11926813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGATGGGTGCCATTAAAAGC -3'
(R):5'- GCACAGAAAGCTCTTGTACCTTATG -3'

Sequencing Primer
(F):5'- AGTACTTCAGAGTCCTCTAGCAC -3'
(R):5'- GGTTGTACTGTTGAGGCTAAAAAC -3'
Posted On2018-06-22