Incidental Mutation 'R6614:Olfr728'
ID523868
Institutional Source Beutler Lab
Gene Symbol Olfr728
Ensembl Gene ENSMUSG00000050030
Gene Nameolfactory receptor 728
SynonymsMOR246-1P, GA_x6K02T2PMLR-5831021-5830086
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50133758-50142680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50140364 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 92 (I92F)
Ref Sequence ENSEMBL: ENSMUSP00000149796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051563] [ENSMUST00000213163] [ENSMUST00000213685] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect probably damaging
Transcript: ENSMUST00000051563
AA Change: I92F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052079
Gene: ENSMUSG00000050030
AA Change: I92F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 9.8e-43 PFAM
Pfam:7TM_GPCR_Srx 31 304 9.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 35 297 6.5e-9 PFAM
Pfam:7tm_1 41 287 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213163
Predicted Effect probably damaging
Transcript: ENSMUST00000213685
AA Change: I92F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214046
Predicted Effect probably benign
Transcript: ENSMUST00000215327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215329
Predicted Effect probably benign
Transcript: ENSMUST00000215451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216423
Meta Mutation Damage Score 0.3657 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Olfr728
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr728 APN 14 50140054 missense probably benign 0.06
IGL02080:Olfr728 APN 14 50140122 missense probably damaging 1.00
IGL03187:Olfr728 APN 14 50139800 missense probably damaging 0.98
R1613:Olfr728 UTSW 14 50140294 missense probably damaging 1.00
R1671:Olfr728 UTSW 14 50139833 missense probably damaging 1.00
R1876:Olfr728 UTSW 14 50140172 missense probably damaging 0.99
R2085:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2086:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2158:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2226:Olfr728 UTSW 14 50140619 missense probably damaging 1.00
R2516:Olfr728 UTSW 14 50139983 missense probably benign
R4454:Olfr728 UTSW 14 50140496 missense probably benign 0.00
R4714:Olfr728 UTSW 14 50139979 missense possibly damaging 0.55
R4754:Olfr728 UTSW 14 50140033 missense possibly damaging 0.90
R4754:Olfr728 UTSW 14 50140034 missense probably benign 0.02
R5275:Olfr728 UTSW 14 50140496 missense probably benign 0.35
R5339:Olfr728 UTSW 14 50140302 missense probably damaging 0.96
R6713:Olfr728 UTSW 14 50139724 missense probably benign
R6900:Olfr728 UTSW 14 50139838 missense possibly damaging 0.94
R7062:Olfr728 UTSW 14 50140450 missense probably damaging 1.00
R7192:Olfr728 UTSW 14 50140120 missense possibly damaging 0.48
R7528:Olfr728 UTSW 14 50139820 missense possibly damaging 0.93
R7740:Olfr728 UTSW 14 50140346 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GATACCTACTGCCCAAGAAATTGAC -3'
(R):5'- AATCTTGGGGACTTCAGCTTG -3'

Sequencing Primer
(F):5'- CCTGTCATATCCCATAGCTAC -3'
(R):5'- CTTTGTCATCTATGTGACATCAGTC -3'
Posted On2018-06-22