Incidental Mutation 'R6614:Lima1'
ID523878
Institutional Source Beutler Lab
Gene Symbol Lima1
Ensembl Gene ENSMUSG00000023022
Gene NameLIM domain and actin binding 1
Synonyms3526402A12Rik, 1110021C24Rik, EPLIN, epithelial protein lost in neoplasm
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99778470-99875456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99783580 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 243 (A243V)
Ref Sequence ENSEMBL: ENSMUSP00000104652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073691] [ENSMUST00000109024]
Predicted Effect probably damaging
Transcript: ENSMUST00000073691
AA Change: A403V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073371
Gene: ENSMUSG00000023022
AA Change: A403V

DomainStartEndE-ValueType
LIM 387 439 5.14e-17 SMART
low complexity region 534 546 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 747 753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109024
AA Change: A243V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104652
Gene: ENSMUSG00000023022
AA Change: A243V

DomainStartEndE-ValueType
LIM 227 279 5.14e-17 SMART
low complexity region 374 386 N/A INTRINSIC
low complexity region 410 427 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
low complexity region 587 593 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172119
Meta Mutation Damage Score 0.3750 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that inhibits actin filament depolymerization and cross-links filaments in bundles. It is downregulated in some cancer cell lines. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and expression of some of the variants maybe independently regulated. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Lima1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Lima1 APN 15 99802157 missense possibly damaging 0.47
IGL01104:Lima1 APN 15 99843700 missense probably damaging 1.00
IGL02618:Lima1 APN 15 99802216 splice site probably benign
IGL03124:Lima1 APN 15 99796734 splice site probably benign
R0312:Lima1 UTSW 15 99781087 missense possibly damaging 0.69
R0599:Lima1 UTSW 15 99802159 missense probably damaging 1.00
R0601:Lima1 UTSW 15 99780472 missense probably damaging 0.98
R1423:Lima1 UTSW 15 99819745 nonsense probably null
R1704:Lima1 UTSW 15 99819736 missense probably benign 0.00
R1784:Lima1 UTSW 15 99780463 missense possibly damaging 0.93
R1819:Lima1 UTSW 15 99819936 missense probably benign 0.01
R1968:Lima1 UTSW 15 99819684 missense probably benign
R2352:Lima1 UTSW 15 99794515 missense probably benign 0.02
R2908:Lima1 UTSW 15 99802110 critical splice donor site probably null
R4582:Lima1 UTSW 15 99780992 missense possibly damaging 0.65
R4672:Lima1 UTSW 15 99843709 missense probably damaging 1.00
R4858:Lima1 UTSW 15 99819576 missense probably benign 0.23
R6140:Lima1 UTSW 15 99781058 missense probably damaging 1.00
R6898:Lima1 UTSW 15 99781267 missense possibly damaging 0.61
R7598:Lima1 UTSW 15 99819696 missense probably benign 0.01
R7601:Lima1 UTSW 15 99819696 missense probably benign 0.01
R7878:Lima1 UTSW 15 99819550 missense probably benign 0.12
R8219:Lima1 UTSW 15 99780790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCCAGCAGTGTTAATAC -3'
(R):5'- TACAGAAATCCAGGAGAGCCTC -3'

Sequencing Primer
(F):5'- GCCCCAGCAGTGTTAATACAGTTG -3'
(R):5'- AGAATCTGAGCAGGGTGTAGTTCC -3'
Posted On2018-06-22