Incidental Mutation 'R6578:Igdcc3'
ID523879
Institutional Source Beutler Lab
Gene Symbol Igdcc3
Ensembl Gene ENSMUSG00000032394
Gene Nameimmunoglobulin superfamily, DCC subclass, member 3
SynonymsPunc, WI-14920, 2810401C09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6578 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location65141189-65185872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65182019 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 499 (D499G)
Ref Sequence ENSEMBL: ENSMUSP00000149084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034961] [ENSMUST00000217371]
Predicted Effect probably damaging
Transcript: ENSMUST00000034961
AA Change: D499G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034961
Gene: ENSMUSG00000032394
AA Change: D499G

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
IGc2 66 136 1.28e-10 SMART
IGc2 163 228 4.77e-10 SMART
IGc2 262 326 8.06e-8 SMART
IGc2 354 419 3.17e-15 SMART
FN3 436 519 1.2e-13 SMART
FN3 534 615 2.66e-6 SMART
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217135
Predicted Effect probably damaging
Transcript: ENSMUST00000217371
AA Change: D499G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Homozygotes for a gene trap mutation exhibit reduced performance on the rotarod, suggesting impaired cerebellar function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Igdcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Igdcc3 APN 9 65182019 missense probably damaging 1.00
IGL01310:Igdcc3 APN 9 65178442 missense probably damaging 0.98
IGL01545:Igdcc3 APN 9 65180073 missense probably damaging 1.00
IGL01576:Igdcc3 APN 9 65177870 missense probably damaging 1.00
IGL01909:Igdcc3 APN 9 65144537 missense probably damaging 1.00
IGL02039:Igdcc3 APN 9 65183880 missense probably benign 0.18
IGL02055:Igdcc3 APN 9 65181280 missense possibly damaging 0.92
IGL02565:Igdcc3 APN 9 65180188 missense probably damaging 1.00
R1776:Igdcc3 UTSW 9 65182752 nonsense probably null
R4731:Igdcc3 UTSW 9 65181997 missense probably damaging 1.00
R5413:Igdcc3 UTSW 9 65177515 missense possibly damaging 0.61
R5487:Igdcc3 UTSW 9 65181584 missense probably damaging 1.00
R5744:Igdcc3 UTSW 9 65141488 small deletion probably benign
R6867:Igdcc3 UTSW 9 65183038 missense probably damaging 1.00
R6992:Igdcc3 UTSW 9 65181571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGACCCTCAGAAGAGCTC -3'
(R):5'- GCCTGAGCGTCTATAATTTTGTATC -3'

Sequencing Primer
(F):5'- GAAGAGCTCTGTCATCCACTC -3'
(R):5'- GGACTGAATCTCTGAACCTGTAAGC -3'
Posted On2018-06-22