Incidental Mutation 'R6614:Serac1'
ID523880
Institutional Source Beutler Lab
Gene Symbol Serac1
Ensembl Gene ENSMUSG00000015659
Gene Nameserine active site containing 1
Synonyms4930511N22Rik, D17Ertd141e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location6042196-6079741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6045662 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 604 (V604E)
Ref Sequence ENSEMBL: ENSMUSP00000095043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000061091] [ENSMUST00000097432] [ENSMUST00000115788]
Predicted Effect probably damaging
Transcript: ENSMUST00000024570
AA Change: V574E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659
AA Change: V574E

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
SCOP:d1jdha_ 243 336 3e-5 SMART
Pfam:PGAP1 360 519 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061091
SMART Domains Protein: ENSMUSP00000060382
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 2.5e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097432
AA Change: V604E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659
AA Change: V604E

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
SCOP:d1gw5a_ 89 464 3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115788
SMART Domains Protein: ENSMUSP00000111454
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 4.8e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153325
Meta Mutation Damage Score 0.9606 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Serac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Serac1 APN 17 6074253 splice site probably benign
IGL02642:Serac1 APN 17 6045746 missense possibly damaging 0.56
IGL02972:Serac1 APN 17 6070764 nonsense probably null
FR4304:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4340:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4342:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4589:Serac1 UTSW 17 6070808 missense probably damaging 1.00
PIT4480001:Serac1 UTSW 17 6050812 missense probably damaging 1.00
R0076:Serac1 UTSW 17 6064937 splice site probably benign
R0076:Serac1 UTSW 17 6064937 splice site probably benign
R0127:Serac1 UTSW 17 6048840 missense probably damaging 1.00
R0211:Serac1 UTSW 17 6050060 missense possibly damaging 0.67
R0245:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0538:Serac1 UTSW 17 6048826 splice site probably benign
R0652:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0988:Serac1 UTSW 17 6061580 missense probably benign 0.02
R1965:Serac1 UTSW 17 6048999 missense possibly damaging 0.72
R1984:Serac1 UTSW 17 6045689 splice site probably null
R2145:Serac1 UTSW 17 6050785 missense probably damaging 1.00
R3426:Serac1 UTSW 17 6066778 missense probably benign 0.04
R3921:Serac1 UTSW 17 6066792 missense probably damaging 1.00
R4760:Serac1 UTSW 17 6051790 missense possibly damaging 0.69
R4958:Serac1 UTSW 17 6069382 missense probably benign 0.15
R5552:Serac1 UTSW 17 6056692 nonsense probably null
R5874:Serac1 UTSW 17 6043913 unclassified probably benign
R5964:Serac1 UTSW 17 6065049 missense probably benign
R6794:Serac1 UTSW 17 6051710 missense probably damaging 1.00
R6949:Serac1 UTSW 17 6051815 missense probably damaging 1.00
R7157:Serac1 UTSW 17 6074201 missense probably benign
R7161:Serac1 UTSW 17 6065076 missense probably damaging 0.97
R7426:Serac1 UTSW 17 6069314 missense probably damaging 1.00
R8270:Serac1 UTSW 17 6050758 missense probably damaging 1.00
Z1088:Serac1 UTSW 17 6048918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTTGCAGAGGGTTTTAATC -3'
(R):5'- GCCCGGCATGAATCAGAAAC -3'

Sequencing Primer
(F):5'- TCTGGTGCTGAAGAGTGAAATC -3'
(R):5'- TCCTCTCTGAGTTAAATACGAACAC -3'
Posted On2018-06-22