Mutagenetix > Incidental Mutations

Incidental Mutation 'R6578:Nin'

523890

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6578 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70061194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 208 (V208A)

Ref Sequence

ENSEMBL: ENSMUSP00000152350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000221275] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021468
AA Change: V208A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: V208A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085314
AA Change: V208A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: V208A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095666
AA Change: V208A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: V208A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169074
AA Change: V208A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: V208A

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220689
AA Change: V208A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221141

Predicted Effect

probably benign
Transcript: ENSMUST00000221275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221486

Predicted Effect

probably benign
Transcript: ENSMUST00000222237
AA Change: V208A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000222835
AA Change: V208A

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223257
AA Change: V208A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 96.8%
20x: 89.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	G	A	6: 146,953,314	R77*	probably null	Het
Aldh9a1	A	G	1: 167,355,759	Y182C	probably damaging	Het
Alpk3	T	A	7: 81,078,684	S521T	probably benign	Het
Ankzf1	A	G	1: 75,197,757	R464G	possibly damaging	Het
Baz2b	T	C	2: 59,969,279	E232G	possibly damaging	Het
Bbs2	T	C	8: 94,077,041	S524G	probably null	Het
Casp1	A	G	9: 5,304,280	K318R	probably benign	Het
Clock	T	A	5: 76,216,709	Q853L	unknown	Het
Clstn3	A	G	6: 124,450,704		probably null	Het
Ebpl	A	C	14: 61,360,320	V24G	probably benign	Het
Erbb2	T	C	11: 98,428,188	C568R	probably damaging	Het
Gcm2	A	G	13: 41,105,678	I105T	probably damaging	Het
Gm7145	C	T	1: 117,985,795	P136S	probably damaging	Het
Helb	G	T	10: 120,111,181	R76S	probably damaging	Het
Hipk4	T	C	7: 27,528,387	I186T	probably damaging	Het
Igdcc3	A	G	9: 65,182,019	D499G	probably damaging	Het
Krt26	T	A	11: 99,334,802	Q284H	probably damaging	Het
Lama4	T	C	10: 39,017,365	I156T	probably benign	Het
Mical2	T	A	7: 112,311,445	F274Y	probably damaging	Het
Mug1	A	T	6: 121,887,452	Q1436L	probably benign	Het
Olfr1181	T	C	2: 88,423,144	S294G	probably benign	Het
Pappa	T	A	4: 65,156,137	N309K	possibly damaging	Het
Pdcd11	T	C	19: 47,111,081	V873A	probably benign	Het
Phf14	G	A	6: 11,991,997	C724Y	probably damaging	Het
Pik3r2	T	G	8: 70,772,639	I127L	probably benign	Het
Polr1a	T	A	6: 71,976,041	M1531K	possibly damaging	Het
Pwwp2b	T	C	7: 139,256,112	C490R	probably damaging	Het
Rax	T	C	18: 65,938,667	T50A	probably benign	Het
Rbm28	A	T	6: 29,137,640	I438N	probably damaging	Het
Sema4c	C	T	1: 36,550,753	V507I	probably benign	Het
Skint8	C	T	4: 111,936,962	T183I	probably benign	Het
Spata16	C	T	3: 26,667,548	Q73*	probably null	Het
Sync	T	C	4: 129,294,267	L364P	probably damaging	Het
Syne1	T	A	10: 5,405,454	K376*	probably null	Het
Tanc1	C	T	2: 59,795,954	R552C	probably damaging	Het
Tdrd6	T	C	17: 43,628,961	I399V	possibly damaging	Het
Vps13b	T	C	15: 35,446,101	C455R	probably damaging	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- TCTGCCACAAAACATGACTTTC -3'
(R):5'- CACTGTCTCTGTGCAAGTCC -3'

Sequencing Primer
(F):5'- GACTTTCCCAAATCTTGTAGAATGTC -3'
(R):5'- CTCTGTGCAAGTCCTTTGGAGAC -3'

Posted On

2018-06-22