Incidental Mutation 'R6578:Nin'
ID 523890
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6578 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 70011435-70113717 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70061194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000152350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000221275] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect possibly damaging
Transcript: ENSMUST00000021468
AA Change: V208A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: V208A

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085314
AA Change: V208A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: V208A

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095666
AA Change: V208A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: V208A

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169074
AA Change: V208A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: V208A

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220689
AA Change: V208A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221141
Predicted Effect probably benign
Transcript: ENSMUST00000221275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect probably benign
Transcript: ENSMUST00000222237
AA Change: V208A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000222835
AA Change: V208A

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000223257
AA Change: V208A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7170:Nin UTSW 12 70044239 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7431:Nin UTSW 12 70078223 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7683:Nin UTSW 12 70078182 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8138:Nin UTSW 12 70042898 missense
R8141:Nin UTSW 12 70030021 missense
R8754:Nin UTSW 12 70031013 intron probably benign
R8790:Nin UTSW 12 70021019 missense
R8899:Nin UTSW 12 70030936 missense probably damaging 1.00
R8974:Nin UTSW 12 70078158 missense
R9085:Nin UTSW 12 70030012 nonsense probably null
R9143:Nin UTSW 12 70090575 missense
R9380:Nin UTSW 12 70028031 missense
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer
(F):5'- TCTGCCACAAAACATGACTTTC -3'
(R):5'- CACTGTCTCTGTGCAAGTCC -3'

Sequencing Primer
(F):5'- GACTTTCCCAAATCTTGTAGAATGTC -3'
(R):5'- CTCTGTGCAAGTCCTTTGGAGAC -3'
Posted On 2018-06-22