Incidental Mutation 'R6614:Nol4'
ID523892
Institutional Source Beutler Lab
Gene Symbol Nol4
Ensembl Gene ENSMUSG00000041923
Gene Namenucleolar protein 4
Synonyms4930568N03Rik, 1700013J13Rik, LOC383304
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location22693181-23041653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 22920856 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 200 (K200Q)
Ref Sequence ENSEMBL: ENSMUSP00000095256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081423] [ENSMUST00000097651] [ENSMUST00000164186] [ENSMUST00000164893] [ENSMUST00000165323]
Predicted Effect probably damaging
Transcript: ENSMUST00000081423
AA Change: K127Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080150
Gene: ENSMUSG00000041923
AA Change: K127Q

DomainStartEndE-ValueType
low complexity region 139 155 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 487 506 N/A INTRINSIC
low complexity region 513 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097651
AA Change: K200Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095256
Gene: ENSMUSG00000041923
AA Change: K200Q

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097652
Predicted Effect probably damaging
Transcript: ENSMUST00000164186
AA Change: K200Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130950
Gene: ENSMUSG00000041923
AA Change: K200Q

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 560 579 N/A INTRINSIC
low complexity region 586 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164893
AA Change: K200Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127870
Gene: ENSMUSG00000041923
AA Change: K200Q

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 522 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165323
AA Change: K86Q

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125860
Gene: ENSMUSG00000041923
AA Change: K86Q

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
Meta Mutation Damage Score 0.1291 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Nol4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Nol4 APN 18 22823412 missense probably benign 0.15
IGL00677:Nol4 APN 18 22921867 missense probably damaging 1.00
IGL01153:Nol4 APN 18 22769793 missense probably damaging 1.00
IGL01400:Nol4 APN 18 22823498 missense probably damaging 0.99
IGL02006:Nol4 APN 18 22921918 missense probably damaging 1.00
IGL02342:Nol4 APN 18 22770869 splice site probably benign
IGL02501:Nol4 APN 18 22823341 missense probably damaging 1.00
PIT4378001:Nol4 UTSW 18 23039876 missense probably damaging 1.00
R0096:Nol4 UTSW 18 22921858 missense possibly damaging 0.95
R0097:Nol4 UTSW 18 22719141 missense probably benign 0.23
R0097:Nol4 UTSW 18 22719141 missense probably benign 0.23
R1257:Nol4 UTSW 18 22770681 missense probably damaging 1.00
R1793:Nol4 UTSW 18 22769821 missense probably damaging 1.00
R2101:Nol4 UTSW 18 22823409 missense probably damaging 1.00
R2357:Nol4 UTSW 18 23039910 missense probably benign 0.01
R2414:Nol4 UTSW 18 22823572 critical splice acceptor site probably null
R2427:Nol4 UTSW 18 22850698 intron probably benign
R3713:Nol4 UTSW 18 23039937 missense probably damaging 1.00
R3734:Nol4 UTSW 18 22770864 splice site probably benign
R3803:Nol4 UTSW 18 22694955 missense probably damaging 1.00
R4458:Nol4 UTSW 18 22751995 missense probably damaging 0.99
R4736:Nol4 UTSW 18 22718993 missense probably damaging 1.00
R4774:Nol4 UTSW 18 22912626 missense probably damaging 0.96
R4795:Nol4 UTSW 18 22921887 missense probably damaging 1.00
R5245:Nol4 UTSW 18 22695122 makesense probably null
R5980:Nol4 UTSW 18 22952201 missense probably damaging 0.97
R6372:Nol4 UTSW 18 23038556 critical splice donor site probably null
R6485:Nol4 UTSW 18 22770793 missense probably damaging 1.00
R6809:Nol4 UTSW 18 22920825 missense probably damaging 1.00
R6877:Nol4 UTSW 18 22719129 missense probably benign 0.06
R7269:Nol4 UTSW 18 23039789 missense probably benign
R7310:Nol4 UTSW 18 22770744 missense
R7720:Nol4 UTSW 18 23040023 missense probably benign 0.16
R7753:Nol4 UTSW 18 23038602 start codon destroyed probably benign 0.15
R7897:Nol4 UTSW 18 22823343 missense
R7974:Nol4 UTSW 18 22719025 nonsense probably null
R8297:Nol4 UTSW 18 23040012 missense probably damaging 0.99
R8303:Nol4 UTSW 18 23040174 unclassified probably benign
Z1088:Nol4 UTSW 18 22921902 missense probably damaging 1.00
Z1177:Nol4 UTSW 18 22769840 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGTGAGGTCCTGGTGAAATTTC -3'
(R):5'- ACTGCTCATGGACATTTGCTTG -3'

Sequencing Primer
(F):5'- AGGTCCTGGTGAAATTTCTTTTC -3'
(R):5'- CTTGGTTTCCAATCATTAATGTGCAG -3'
Posted On2018-06-22