Incidental Mutation 'R6578:Gcm2'
ID523893
Institutional Source Beutler Lab
Gene Symbol Gcm2
Ensembl Gene ENSMUSG00000021362
Gene Nameglial cells missing homolog 2
SynonymsGcm1-rs2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R6578 (G1)
Quality Score206.009
Status Validated
Chromosome13
Chromosomal Location41101427-41111035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41105678 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 105 (I105T)
Ref Sequence ENSEMBL: ENSMUSP00000153244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021791] [ENSMUST00000225271]
Predicted Effect probably damaging
Transcript: ENSMUST00000021791
AA Change: I105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021791
Gene: ENSMUSG00000021362
AA Change: I105T

DomainStartEndE-ValueType
Pfam:GCM 35 172 4.8e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225271
AA Change: I105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225420
Meta Mutation Damage Score 0.5946 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila glial cells missing gene, which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lack parathyroid glands and exhibit hypocalcemia, hypophosphatemia, a mild abnormal bone phenotype, and partial perinatal lethality. Hypoparathyroidism is observed although parathyroid hormone serum levels are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rax T C 18: 65,938,667 T50A probably benign Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Gcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Gcm2 APN 13 41103131 missense probably damaging 1.00
IGL01476:Gcm2 APN 13 41105741 missense probably damaging 1.00
IGL02034:Gcm2 APN 13 41105793 missense probably damaging 1.00
IGL02186:Gcm2 APN 13 41104649 missense possibly damaging 0.93
IGL02456:Gcm2 APN 13 41103001 missense probably benign 0.01
IGL03142:Gcm2 APN 13 41103235 missense probably benign 0.01
IGL03184:Gcm2 APN 13 41105412 missense probably damaging 1.00
PIT4403001:Gcm2 UTSW 13 41102839 missense probably benign 0.01
R0227:Gcm2 UTSW 13 41105856 missense probably damaging 0.99
R1061:Gcm2 UTSW 13 41105871 missense probably damaging 1.00
R1813:Gcm2 UTSW 13 41105891 missense probably benign 0.19
R2057:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2058:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2059:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2351:Gcm2 UTSW 13 41103618 missense probably benign 0.02
R4653:Gcm2 UTSW 13 41102841 missense probably benign 0.21
R4782:Gcm2 UTSW 13 41103494 missense possibly damaging 0.66
R4799:Gcm2 UTSW 13 41103494 missense possibly damaging 0.66
R5135:Gcm2 UTSW 13 41102959 missense probably benign
R5162:Gcm2 UTSW 13 41103655 missense probably benign 0.01
R5665:Gcm2 UTSW 13 41109911 missense possibly damaging 0.73
R5756:Gcm2 UTSW 13 41109896 missense probably damaging 1.00
R5771:Gcm2 UTSW 13 41103515 missense probably benign 0.40
R5928:Gcm2 UTSW 13 41103398 missense probably benign 0.00
R5977:Gcm2 UTSW 13 41103127 missense probably damaging 0.99
R6394:Gcm2 UTSW 13 41109897 missense probably damaging 1.00
R6798:Gcm2 UTSW 13 41105885 missense probably damaging 1.00
R7088:Gcm2 UTSW 13 41103364 missense probably damaging 0.98
R7413:Gcm2 UTSW 13 41105754 missense probably damaging 1.00
R7456:Gcm2 UTSW 13 41103275 missense probably benign 0.02
R8293:Gcm2 UTSW 13 41103170 missense probably damaging 1.00
Z1088:Gcm2 UTSW 13 41102792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAAGGTGAGTGACAGTTG -3'
(R):5'- TTTGACCACTTCCGGGAGTG -3'

Sequencing Primer
(F):5'- GGGGCAAGCTTTCTCTGCAAAC -3'
(R):5'- GATGGCTACGTGCGCTTCATC -3'
Posted On2018-06-22