Incidental Mutation 'R6614:Ndufv1'
ID523894
Institutional Source Beutler Lab
Gene Symbol Ndufv1
Ensembl Gene ENSMUSG00000037916
Gene NameNADH dehydrogenase (ubiquinone) flavoprotein 1
Synonyms24 kDa (FP)
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4007497-4012806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4008749 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 253 (T253I)
Ref Sequence ENSEMBL: ENSMUSP00000042967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025806] [ENSMUST00000042497] [ENSMUST00000128787] [ENSMUST00000129706] [ENSMUST00000133474] [ENSMUST00000134479] [ENSMUST00000136921] [ENSMUST00000155405]
Predicted Effect probably benign
Transcript: ENSMUST00000025806
SMART Domains Protein: ENSMUSP00000025806
Gene: ENSMUSG00000024871

DomainStartEndE-ValueType
C2 99 206 1.14e-10 SMART
low complexity region 231 243 N/A INTRINSIC
C2 259 373 5.14e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042497
AA Change: T253I

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042967
Gene: ENSMUSG00000037916
AA Change: T253I

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 252 2.4e-52 PFAM
Pfam:SLBB 275 327 5.1e-10 PFAM
NADH_4Fe-4S 364 409 1.05e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127016
Predicted Effect probably benign
Transcript: ENSMUST00000128787
AA Change: T244I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000123069
Gene: ENSMUSG00000037916
AA Change: T244I

DomainStartEndE-ValueType
Pfam:Complex1_51K 71 243 1.6e-52 PFAM
Pfam:SLBB 266 318 8.6e-10 PFAM
NADH_4Fe-4S 355 400 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129706
SMART Domains Protein: ENSMUSP00000115653
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 115 1.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132747
Predicted Effect probably benign
Transcript: ENSMUST00000133474
SMART Domains Protein: ENSMUSP00000120223
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 146 3.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134049
Predicted Effect probably benign
Transcript: ENSMUST00000134479
AA Change: T174I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000121915
Gene: ENSMUSG00000037916
AA Change: T174I

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 173 3.6e-53 PFAM
Pfam:SLBB 196 248 5.2e-11 PFAM
NADH_4Fe-4S 285 330 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136921
SMART Domains Protein: ENSMUSP00000123680
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 114 6.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148283
Predicted Effect probably benign
Transcript: ENSMUST00000155405
SMART Domains Protein: ENSMUSP00000119218
Gene: ENSMUSG00000024869

DomainStartEndE-ValueType
Pfam:NUDIX 29 159 8.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149482
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. This gene is a core subunit and is conserved in prokaryotes and eukaryotes. The human ortholog of this protein has been characterized. It has consensus motifs for NADH, flavin mononucleotide, and iron-sulfur binding sites and participates in the oxidation of NADH as part of the dehydrogenase module of complex I. In humans, deficiencies in complex I are associated with myopathies, encephalomyopathies, and neurodegenerative disorders. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Psd T C 19: 46,313,412 K913E probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Ndufv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Ndufv1 APN 19 4008803 missense probably benign 0.03
IGL02376:Ndufv1 APN 19 4007823 splice site probably null
R1929:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R2270:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R2271:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R3917:Ndufv1 UTSW 19 4010002 missense probably damaging 1.00
R4844:Ndufv1 UTSW 19 4012574 missense probably benign 0.00
R4875:Ndufv1 UTSW 19 4012653 splice site probably null
R5188:Ndufv1 UTSW 19 4009988 missense probably damaging 1.00
R5853:Ndufv1 UTSW 19 4008811 splice site probably null
R7791:Ndufv1 UTSW 19 4011533 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAGTTGGCTCCAGGCTTAC -3'
(R):5'- ACTAACAAGAGTCATGTTCCCAG -3'

Sequencing Primer
(F):5'- ACCAGCATGTTTCTCAATCAGC -3'
(R):5'- TGAATCTCGAGTTCAAGGCC -3'
Posted On2018-06-22