Incidental Mutation 'R6614:Psd'
ID523902
Institutional Source Beutler Lab
Gene Symbol Psd
Ensembl Gene ENSMUSG00000037126
Gene Namepleckstrin and Sec7 domain containing
SynonymsPsdl, Efa6a, Efa6, 1110007H17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6614 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46312087-46327156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46313412 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 913 (K913E)
Ref Sequence ENSEMBL: ENSMUSP00000152942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]
Predicted Effect probably benign
Transcript: ENSMUST00000041391
AA Change: K912E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126
AA Change: K912E

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073116
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096029
AA Change: K913E

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126
AA Change: K913E

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111881
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224556
AA Change: K281E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000225323
AA Change: K913E

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226062
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T A 8: 124,861,247 probably null Het
4932415D10Rik T A 10: 82,291,648 N1843Y probably benign Het
Abca13 A T 11: 9,294,371 N2078I probably benign Het
Abcc2 A G 19: 43,819,361 I814V probably benign Het
Adamts4 A G 1: 171,256,624 R557G probably benign Het
Bysl A T 17: 47,601,842 L341Q probably damaging Het
C130026I21Rik A C 1: 85,202,060 probably null Het
Csmd1 C T 8: 17,216,787 G41D probably damaging Het
Dnah11 T C 12: 117,886,676 D4221G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dnajc21 A G 15: 10,470,263 probably null Het
Elavl1 C A 8: 4,289,818 A255S probably damaging Het
Filip1 C T 9: 79,815,839 G1166D probably damaging Het
Gm17727 A G 9: 35,777,125 W55R probably damaging Het
Gnptg T C 17: 25,235,261 Y184C probably damaging Het
Ifit3b A T 19: 34,611,519 S32C probably benign Het
Kcnh7 T G 2: 62,777,596 Y547S probably damaging Het
Lima1 G A 15: 99,783,580 A243V probably damaging Het
Mast3 T A 8: 70,781,966 I67F possibly damaging Het
Ncor1 A C 11: 62,330,819 M1283R probably benign Het
Ndufv1 G A 19: 4,008,749 T253I probably benign Het
Neurog1 G T 13: 56,251,824 Q37K probably benign Het
Nol4 T G 18: 22,920,856 K200Q probably damaging Het
Obscn T C 11: 59,012,801 H7599R probably benign Het
Olfr57 C A 10: 79,035,091 C98* probably null Het
Olfr728 T A 14: 50,140,364 I92F probably damaging Het
Olfr733 T A 14: 50,299,037 I91L probably benign Het
Olfr739 C T 14: 50,425,089 T190I probably benign Het
Olfr96 T C 17: 37,225,899 V258A probably benign Het
Oog4 A G 4: 143,437,875 V362A possibly damaging Het
Oosp1 T A 19: 11,690,950 D23V probably damaging Het
P2rx3 A G 2: 85,035,199 I34T probably damaging Het
Pla2g4a A T 1: 149,842,235 V621E probably benign Het
Prpf39 T G 12: 65,042,563 V25G probably benign Het
Ptx4 A T 17: 25,122,702 R50S possibly damaging Het
Rex2 A T 4: 147,052,561 M16L probably benign Het
Serac1 A T 17: 6,045,662 V604E probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp6 T A 12: 44,861,275 T187S probably benign Het
Tg G A 15: 66,735,259 C215Y probably damaging Het
Top2b A T 14: 16,407,142 K671* probably null Het
Trmt1 G T 8: 84,689,333 V7L probably benign Het
Ttn C T 2: 76,784,830 R15102H probably benign Het
Uhrf1bp1 T A 17: 27,876,925 I70N probably benign Het
Unc79 A T 12: 102,991,430 I35F probably damaging Het
Other mutations in Psd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Psd APN 19 46314747 missense possibly damaging 0.77
IGL01307:Psd APN 19 46314658 missense probably damaging 1.00
IGL02329:Psd APN 19 46319659 missense possibly damaging 0.66
IGL02423:Psd APN 19 46314504 missense possibly damaging 0.95
IGL02644:Psd APN 19 46323395 missense probably damaging 1.00
IGL02724:Psd APN 19 46319545 missense probably benign 0.04
IGL03117:Psd APN 19 46323122 unclassified probably benign
ANU05:Psd UTSW 19 46314747 missense possibly damaging 0.77
P0035:Psd UTSW 19 46320961 missense possibly damaging 0.56
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0403:Psd UTSW 19 46320972 unclassified probably benign
R0499:Psd UTSW 19 46322161 missense probably damaging 0.98
R0542:Psd UTSW 19 46314210 missense probably damaging 1.00
R0543:Psd UTSW 19 46319517 missense possibly damaging 0.62
R0894:Psd UTSW 19 46313441 missense probably damaging 1.00
R1449:Psd UTSW 19 46324811 missense probably damaging 0.99
R1586:Psd UTSW 19 46314798 missense probably damaging 0.98
R2096:Psd UTSW 19 46324649 splice site probably null
R2504:Psd UTSW 19 46324913 missense possibly damaging 0.90
R2857:Psd UTSW 19 46324420 missense probably benign 0.00
R2863:Psd UTSW 19 46314762 missense probably damaging 0.97
R3897:Psd UTSW 19 46324585 missense possibly damaging 0.93
R3967:Psd UTSW 19 46324406 missense probably benign
R3970:Psd UTSW 19 46324406 missense probably benign
R4435:Psd UTSW 19 46314494 missense probably damaging 1.00
R4612:Psd UTSW 19 46313339 missense probably benign 0.15
R4940:Psd UTSW 19 46322417 missense probably damaging 1.00
R5055:Psd UTSW 19 46322468 missense probably benign 0.00
R5485:Psd UTSW 19 46316089 splice site probably null
R5768:Psd UTSW 19 46312739 missense possibly damaging 0.84
R5775:Psd UTSW 19 46314772 nonsense probably null
R6057:Psd UTSW 19 46323314 missense possibly damaging 0.77
R6349:Psd UTSW 19 46313387 splice site probably null
R6496:Psd UTSW 19 46320314 missense probably damaging 1.00
R6820:Psd UTSW 19 46320844 missense probably damaging 1.00
R6849:Psd UTSW 19 46317746 missense probably damaging 0.97
R6860:Psd UTSW 19 46322419 missense probably damaging 1.00
R7286:Psd UTSW 19 46314801 missense probably damaging 0.98
R7326:Psd UTSW 19 46324454 missense probably benign 0.01
R7351:Psd UTSW 19 46322430 missense probably benign 0.27
R7593:Psd UTSW 19 46312913 missense possibly damaging 0.47
R7614:Psd UTSW 19 46313438 missense probably damaging 1.00
R7943:Psd UTSW 19 46324730 missense possibly damaging 0.54
Z1177:Psd UTSW 19 46324661 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATGAAGACTTAGAGATCTGCCAGTC -3'
(R):5'- TAGTCCAGGCTGCATGTGTG -3'

Sequencing Primer
(F):5'- GGTTCCAGGCTTAGCTATCAGAC -3'
(R):5'- GGTTAGACATTTGTGCAGGAGTCC -3'
Posted On2018-06-22