Incidental Mutation 'R6615:Olfr1281'
ID523911
Institutional Source Beutler Lab
Gene Symbol Olfr1281
Ensembl Gene ENSMUSG00000095156
Gene Nameolfactory receptor 1281
SynonymsGA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6615 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111326520-111332852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111329112 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 231 (D231G)
Ref Sequence ENSEMBL: ENSMUSP00000151304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090326] [ENSMUST00000208176] [ENSMUST00000213551]
Predicted Effect probably benign
Transcript: ENSMUST00000090326
AA Change: D231G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000087798
Gene: ENSMUSG00000095156
AA Change: D231G

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 301 2.6e-6 PFAM
Pfam:7tm_1 41 287 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208176
AA Change: D231G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000213551
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,112,485 N402K probably damaging Het
Avl9 T C 6: 56,753,885 V598A probably benign Het
Bcar3 T A 3: 122,426,633 S60T probably benign Het
Bean1 CT C 8: 104,182,032 probably null Homo
Calm3 A G 7: 16,917,583 probably null Het
Ccdc113 A C 8: 95,545,992 E242D probably benign Het
Celsr1 C T 15: 85,902,114 probably null Het
Clhc1 T A 11: 29,578,149 M559K possibly damaging Het
Dhx36 T A 3: 62,488,917 I440L probably benign Het
Dnah7c A T 1: 46,515,439 T445S probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dsc2 T A 18: 20,032,519 H843L possibly damaging Het
F11 T C 8: 45,248,774 Y333C probably benign Het
Fbxo41 T C 6: 85,478,523 T560A possibly damaging Het
Fbxo7 A T 10: 86,044,534 H282L possibly damaging Het
Gmnc T G 16: 26,960,528 D243A probably benign Het
Hdac5 C A 11: 102,197,056 probably null Het
Krt87 A G 15: 101,436,562 V188A probably benign Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrk1 A T 7: 66,281,648 L55Q probably damaging Het
Ltbp2 C T 12: 84,813,317 C621Y probably damaging Het
March8 A G 6: 116,405,663 E147G probably damaging Het
Muc16 T G 9: 18,647,188 H2603P unknown Het
Nipa1 T A 7: 55,979,823 N181Y probably damaging Het
Olfr297 A G 7: 86,526,912 T52A probably benign Het
Olfr562-ps1 T C 7: 102,781,787 F104L probably damaging Het
Olfr855 A G 9: 19,584,989 I151V probably benign Het
Olfr92 G A 17: 37,111,602 P127S probably damaging Het
Pcf11 T A 7: 92,657,882 Q1026L probably damaging Het
Ptch1 T G 13: 63,539,830 K378T possibly damaging Het
Ptprm C T 17: 67,353,956 probably null Het
Pxmp2 C A 5: 110,277,707 W154L possibly damaging Het
Rdh7 T G 10: 127,884,622 S294R probably damaging Het
Rexo1 C T 10: 80,544,014 R994Q possibly damaging Het
Sacs A G 14: 61,208,934 T2810A probably benign Het
Serpina3c A T 12: 104,151,721 H119Q possibly damaging Het
Slc12a2 T G 18: 57,898,128 I335R probably damaging Het
Slc25a13 C T 6: 6,073,454 R468Q probably damaging Het
Slc5a6 C T 5: 31,036,830 V628I probably benign Het
Srsf2 T C 11: 116,853,079 probably null Het
Sugp2 A G 8: 70,242,770 Q131R possibly damaging Het
Syne1 T C 10: 5,301,340 R2525G probably damaging Het
Tarsl2 T C 7: 65,678,142 F533S probably damaging Het
Tmem8b G T 4: 43,682,249 G82W probably damaging Het
Unc13c A G 9: 73,930,608 I987T possibly damaging Het
Usp44 T C 10: 93,846,489 V267A possibly damaging Het
Wac C A 18: 7,868,884 probably null Het
Xkr5 T C 8: 18,933,553 I658V probably benign Het
Zbtb38 A T 9: 96,686,654 Y792* probably null Het
Other mutations in Olfr1281
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02426:Olfr1281 APN 2 111328575 missense probably damaging 1.00
IGL02550:Olfr1281 APN 2 111328500 missense probably damaging 1.00
IGL02553:Olfr1281 APN 2 111328988 missense probably benign
IGL02719:Olfr1281 APN 2 111329245 nonsense probably null
IGL02750:Olfr1281 APN 2 111329288 missense probably damaging 1.00
IGL02873:Olfr1281 APN 2 111328872 missense probably benign
IGL03252:Olfr1281 APN 2 111328780 nonsense probably null
IGL03375:Olfr1281 APN 2 111328884 missense probably damaging 1.00
R0055:Olfr1281 UTSW 2 111328525 nonsense probably null
R0368:Olfr1281 UTSW 2 111328787 missense probably damaging 0.99
R0497:Olfr1281 UTSW 2 111328830 missense probably benign 0.00
R0505:Olfr1281 UTSW 2 111329328 missense probably benign 0.00
R1557:Olfr1281 UTSW 2 111328619 missense probably damaging 1.00
R1619:Olfr1281 UTSW 2 111328961 missense probably benign 0.02
R1691:Olfr1281 UTSW 2 111328853 missense probably benign 0.03
R2286:Olfr1281 UTSW 2 111328907 missense probably benign 0.01
R4230:Olfr1281 UTSW 2 111329130 missense probably damaging 1.00
R4274:Olfr1281 UTSW 2 111328815 missense probably damaging 0.98
R4305:Olfr1281 UTSW 2 111329298 missense probably null 0.82
R4495:Olfr1281 UTSW 2 111329020 missense probably benign 0.08
R5307:Olfr1281 UTSW 2 111328396 splice site probably null
R6115:Olfr1281 UTSW 2 111329213 missense probably benign 0.03
R7169:Olfr1281 UTSW 2 111328598 missense probably damaging 1.00
R7601:Olfr1281 UTSW 2 111329220 missense probably benign 0.12
R8267:Olfr1281 UTSW 2 111328815 missense probably benign 0.22
R8447:Olfr1281 UTSW 2 111328962 missense possibly damaging 0.81
Z1177:Olfr1281 UTSW 2 111328825 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCATGCCATTAGTCAGTTGCTC -3'
(R):5'- TAGATTGCTGGATTCAGGAGAG -3'

Sequencing Primer
(F):5'- CATTCTGTGGACCTAGAGTGATAGAC -3'
(R):5'- GGTGTGATGACTGTATAAAACACAGC -3'
Posted On2018-06-22