Incidental Mutation 'R6579:Trak1'
ID523931
Institutional Source Beutler Lab
Gene Symbol Trak1
Ensembl Gene ENSMUSG00000032536
Gene Nametrafficking protein, kinesin binding 1
Synonymshyrt, 2310001H13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R6579 (G1)
Quality Score219.009
Status Validated
Chromosome9
Chromosomal Location121297502-121474918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121443638 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 197 (N197K)
Ref Sequence ENSEMBL: ENSMUSP00000044482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000209995] [ENSMUST00000210351] [ENSMUST00000210636] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]
Predicted Effect probably benign
Transcript: ENSMUST00000045903
AA Change: N197K

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: N197K

DomainStartEndE-ValueType
Pfam:HAP1_N 47 352 8.1e-139 PFAM
Pfam:Milton 411 580 5e-72 PFAM
low complexity region 882 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209995
Predicted Effect probably benign
Transcript: ENSMUST00000210351
AA Change: N147K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000210636
AA Change: N197K

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000210798
AA Change: N94K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000211187
AA Change: N187K

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000211301
AA Change: N94K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000211439
AA Change: N94K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211699
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,224 V80D possibly damaging Het
6330409D20Rik T C 2: 32,740,651 probably benign Het
Adam15 C T 3: 89,345,629 V261M probably damaging Het
Adam29 G T 8: 55,872,744 T225K probably damaging Het
Ankrd52 A G 10: 128,387,142 T654A probably damaging Het
AU021092 T A 16: 5,222,156 I35F probably damaging Het
Casc1 A T 6: 145,179,018 M527K probably benign Het
Cdk20 G T 13: 64,436,534 Q114H probably benign Het
Col22a1 A C 15: 71,881,653 S133A probably benign Het
Cyp3a44 A T 5: 145,790,706 F271Y probably damaging Het
Dchs1 A T 7: 105,762,913 V1332E probably benign Het
Dnajc5 A G 2: 181,547,416 N62D possibly damaging Het
Fam126a A T 5: 23,966,383 V347D possibly damaging Het
Gm3045 C T 13: 56,430,290 S180L probably damaging Het
Gm4756 A T 12: 72,621,884 D117E probably benign Het
Igkv14-130 T A 6: 67,791,437 Y93* probably null Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nell2 A T 15: 95,385,076 Y362N possibly damaging Het
Olfr262 C T 19: 12,241,362 V100I probably benign Het
Peli1 A T 11: 21,147,059 T150S probably benign Het
Pkhd1 T C 1: 20,200,823 T3169A probably benign Het
Polr2m T A 9: 71,485,720 E26V probably damaging Het
Rhbdf2 A G 11: 116,604,463 V238A probably benign Het
Rims1 G T 1: 22,425,916 P820H probably damaging Het
Rnf213 A G 11: 119,436,280 T1698A probably damaging Het
Scgn C T 13: 23,959,734 A216T probably damaging Het
Serpina11 T A 12: 103,984,748 D238V probably damaging Het
Setd2 A T 9: 110,549,778 E887V possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Uchl5 T A 1: 143,798,392 Y211N probably damaging Het
Usf3 T A 16: 44,218,834 S1226T possibly damaging Het
Utrn T C 10: 12,748,006 T163A probably benign Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zcchc14 T C 8: 121,604,467 probably benign Het
Other mutations in Trak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trak1 APN 9 121443736 critical splice donor site probably null
IGL01335:Trak1 APN 9 121454316 missense possibly damaging 0.58
IGL01777:Trak1 APN 9 121431560 splice site probably null
IGL01804:Trak1 APN 9 121442685 splice site probably benign
IGL01986:Trak1 APN 9 121472967 missense probably benign 0.00
IGL02248:Trak1 APN 9 121446794 missense probably damaging 1.00
IGL02276:Trak1 APN 9 121451668 missense probably damaging 1.00
IGL02556:Trak1 APN 9 121448901 missense probably damaging 1.00
IGL03368:Trak1 APN 9 121367122 missense possibly damaging 0.66
PIT4468001:Trak1 UTSW 9 121453332 missense probably benign 0.18
R0067:Trak1 UTSW 9 121472907 missense probably damaging 1.00
R0276:Trak1 UTSW 9 121454338 missense probably damaging 0.97
R0535:Trak1 UTSW 9 121443712 missense probably null 1.00
R0629:Trak1 UTSW 9 121367167 missense probably benign 0.37
R0671:Trak1 UTSW 9 121448955 critical splice donor site probably null
R0883:Trak1 UTSW 9 121453285 missense possibly damaging 0.90
R1160:Trak1 UTSW 9 121392007 missense probably benign 0.01
R1162:Trak1 UTSW 9 121453341 missense possibly damaging 0.93
R1168:Trak1 UTSW 9 121440679 missense probably damaging 1.00
R1398:Trak1 UTSW 9 121454359 missense probably damaging 1.00
R2118:Trak1 UTSW 9 121472997 makesense probably null
R2119:Trak1 UTSW 9 121472997 makesense probably null
R2120:Trak1 UTSW 9 121472997 makesense probably null
R2137:Trak1 UTSW 9 121472962 missense possibly damaging 0.83
R3162:Trak1 UTSW 9 121451734 splice site probably benign
R3888:Trak1 UTSW 9 121442797 splice site probably null
R3889:Trak1 UTSW 9 121445873 missense probably null 0.40
R4031:Trak1 UTSW 9 121451670 missense probably damaging 1.00
R4116:Trak1 UTSW 9 121448843 missense probably damaging 1.00
R4406:Trak1 UTSW 9 121431536 missense probably damaging 1.00
R4630:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4631:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4632:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4786:Trak1 UTSW 9 121472494 missense probably benign 0.25
R5137:Trak1 UTSW 9 121367055 intron probably benign
R5159:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R5467:Trak1 UTSW 9 121446798 missense probably damaging 1.00
R5661:Trak1 UTSW 9 121443637 missense possibly damaging 0.46
R5664:Trak1 UTSW 9 121472307 missense possibly damaging 0.47
R5769:Trak1 UTSW 9 121448838 missense probably damaging 1.00
R6041:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R6257:Trak1 UTSW 9 121446755 missense probably damaging 1.00
R6257:Trak1 UTSW 9 121367224 missense possibly damaging 0.92
R6354:Trak1 UTSW 9 121451726 missense probably null 0.03
R6399:Trak1 UTSW 9 121453496 intron probably null
R6513:Trak1 UTSW 9 121443756 missense probably benign
R6940:Trak1 UTSW 9 121443718 missense possibly damaging 0.78
R7120:Trak1 UTSW 9 121460498 missense probably benign
R7299:Trak1 UTSW 9 121451863 intron probably null
R7304:Trak1 UTSW 9 121416212 missense probably benign
R7396:Trak1 UTSW 9 121448907 missense possibly damaging 0.71
R7522:Trak1 UTSW 9 121442711 missense probably damaging 0.99
R7657:Trak1 UTSW 9 121472586 missense probably damaging 1.00
R7733:Trak1 UTSW 9 121367225 missense possibly damaging 0.92
R7793:Trak1 UTSW 9 121416198 nonsense probably null
R7999:Trak1 UTSW 9 121460425 missense probably damaging 1.00
R8209:Trak1 UTSW 9 121451727 missense probably benign
R8215:Trak1 UTSW 9 121469030 missense probably damaging 1.00
R8226:Trak1 UTSW 9 121451727 missense probably benign
R8261:Trak1 UTSW 9 121451667 missense probably damaging 1.00
R8300:Trak1 UTSW 9 121460499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGAGTTCACATATGAGGCAG -3'
(R):5'- ATGGCACTGTCACTGAAGCTG -3'

Sequencing Primer
(F):5'- TGGCAGCAAGAGTTTTCCC -3'
(R):5'- AGCTGTCGCTGCCAGAG -3'
Posted On2018-06-22