Incidental Mutation 'R6615:Olfr297'
ID523947
Institutional Source Beutler Lab
Gene Symbol Olfr297
Ensembl Gene ENSMUSG00000057067
Gene Nameolfactory receptor 297
SynonymsGA_x6K02T2NHDJ-9587747-9586815, MOR220-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6615 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86519968-86528497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86526912 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 52 (T52A)
Ref Sequence ENSEMBL: ENSMUSP00000134371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071112] [ENSMUST00000172965]
Predicted Effect probably benign
Transcript: ENSMUST00000071112
AA Change: T52A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132942
Gene: ENSMUSG00000057067
AA Change: T52A

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.9e-45 PFAM
Pfam:7tm_1 39 288 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172965
AA Change: T52A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134371
Gene: ENSMUSG00000057067
AA Change: T52A

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.2e-46 PFAM
Pfam:7tm_1 39 288 2e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,112,485 N402K probably damaging Het
Avl9 T C 6: 56,753,885 V598A probably benign Het
Bcar3 T A 3: 122,426,633 S60T probably benign Het
Bean1 CT C 8: 104,182,032 probably null Homo
Calm3 A G 7: 16,917,583 probably null Het
Ccdc113 A C 8: 95,545,992 E242D probably benign Het
Celsr1 C T 15: 85,902,114 probably null Het
Clhc1 T A 11: 29,578,149 M559K possibly damaging Het
Dhx36 T A 3: 62,488,917 I440L probably benign Het
Dnah7c A T 1: 46,515,439 T445S probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dsc2 T A 18: 20,032,519 H843L possibly damaging Het
F11 T C 8: 45,248,774 Y333C probably benign Het
Fbxo41 T C 6: 85,478,523 T560A possibly damaging Het
Fbxo7 A T 10: 86,044,534 H282L possibly damaging Het
Gmnc T G 16: 26,960,528 D243A probably benign Het
Hdac5 C A 11: 102,197,056 probably null Het
Krt87 A G 15: 101,436,562 V188A probably benign Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrk1 A T 7: 66,281,648 L55Q probably damaging Het
Ltbp2 C T 12: 84,813,317 C621Y probably damaging Het
March8 A G 6: 116,405,663 E147G probably damaging Het
Muc16 T G 9: 18,647,188 H2603P unknown Het
Nipa1 T A 7: 55,979,823 N181Y probably damaging Het
Olfr1281 A G 2: 111,329,112 D231G probably benign Het
Olfr562-ps1 T C 7: 102,781,787 F104L probably damaging Het
Olfr855 A G 9: 19,584,989 I151V probably benign Het
Olfr92 G A 17: 37,111,602 P127S probably damaging Het
Pcf11 T A 7: 92,657,882 Q1026L probably damaging Het
Ptch1 T G 13: 63,539,830 K378T possibly damaging Het
Ptprm C T 17: 67,353,956 probably null Het
Pxmp2 C A 5: 110,277,707 W154L possibly damaging Het
Rdh7 T G 10: 127,884,622 S294R probably damaging Het
Rexo1 C T 10: 80,544,014 R994Q possibly damaging Het
Sacs A G 14: 61,208,934 T2810A probably benign Het
Serpina3c A T 12: 104,151,721 H119Q possibly damaging Het
Slc12a2 T G 18: 57,898,128 I335R probably damaging Het
Slc25a13 C T 6: 6,073,454 R468Q probably damaging Het
Slc5a6 C T 5: 31,036,830 V628I probably benign Het
Srsf2 T C 11: 116,853,079 probably null Het
Sugp2 A G 8: 70,242,770 Q131R possibly damaging Het
Syne1 T C 10: 5,301,340 R2525G probably damaging Het
Tarsl2 T C 7: 65,678,142 F533S probably damaging Het
Tmem8b G T 4: 43,682,249 G82W probably damaging Het
Unc13c A G 9: 73,930,608 I987T possibly damaging Het
Usp44 T C 10: 93,846,489 V267A possibly damaging Het
Wac C A 18: 7,868,884 probably null Het
Xkr5 T C 8: 18,933,553 I658V probably benign Het
Zbtb38 A T 9: 96,686,654 Y792* probably null Het
Other mutations in Olfr297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Olfr297 APN 7 86526778 missense probably benign 0.10
IGL01823:Olfr297 APN 7 86527041 missense probably damaging 1.00
PIT4378001:Olfr297 UTSW 7 86527098 missense possibly damaging 0.50
R0304:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R0737:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R2177:Olfr297 UTSW 7 86527662 missense probably benign 0.01
R2436:Olfr297 UTSW 7 86527383 missense probably damaging 0.99
R4289:Olfr297 UTSW 7 86527054 missense probably damaging 1.00
R4639:Olfr297 UTSW 7 86526761 start codon destroyed probably null 1.00
R5202:Olfr297 UTSW 7 86527116 missense probably damaging 1.00
R5782:Olfr297 UTSW 7 86527213 missense probably damaging 0.98
R6446:Olfr297 UTSW 7 86527102 missense possibly damaging 0.90
R6920:Olfr297 UTSW 7 86527314 missense probably benign 0.00
R7150:Olfr297 UTSW 7 86527114 missense probably damaging 1.00
R7309:Olfr297 UTSW 7 86527141 missense probably damaging 1.00
R7621:Olfr297 UTSW 7 86527072 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CTTCCAGATAAACCTGTACTTTGAGAC -3'
(R):5'- ATATGGCCACATAGCGGTC -3'

Sequencing Primer
(F):5'- CTATGATGAATTCTACCATGGTGAC -3'
(R):5'- ATAGCGGTCCTGAGCCATGATG -3'
Posted On2018-06-22