Incidental Mutation 'R6615:Xkr5'
ID523953
Institutional Source Beutler Lab
Gene Symbol Xkr5
Ensembl Gene ENSMUSG00000039814
Gene NameX-linked Kx blood group related 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6615 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location18932729-18950975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18933553 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 658 (I658V)
Ref Sequence ENSEMBL: ENSMUSP00000093089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055503] [ENSMUST00000095438] [ENSMUST00000143913] [ENSMUST00000152974]
Predicted Effect probably benign
Transcript: ENSMUST00000055503
AA Change: I492V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000061748
Gene: ENSMUSG00000039814
AA Change: I492V

DomainStartEndE-ValueType
Pfam:XK-related 1 155 1.4e-46 PFAM
low complexity region 240 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095438
AA Change: I658V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093089
Gene: ENSMUSG00000039814
AA Change: I658V

DomainStartEndE-ValueType
Pfam:XK-related 5 321 1.6e-87 PFAM
low complexity region 406 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143913
SMART Domains Protein: ENSMUSP00000121958
Gene: ENSMUSG00000039814

DomainStartEndE-ValueType
Pfam:XK-related 2 109 2.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144987
Predicted Effect probably benign
Transcript: ENSMUST00000152974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157795
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,112,485 N402K probably damaging Het
Avl9 T C 6: 56,753,885 V598A probably benign Het
Bcar3 T A 3: 122,426,633 S60T probably benign Het
Bean1 CT C 8: 104,182,032 probably null Homo
Calm3 A G 7: 16,917,583 probably null Het
Ccdc113 A C 8: 95,545,992 E242D probably benign Het
Celsr1 C T 15: 85,902,114 probably null Het
Clhc1 T A 11: 29,578,149 M559K possibly damaging Het
Dhx36 T A 3: 62,488,917 I440L probably benign Het
Dnah7c A T 1: 46,515,439 T445S probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dsc2 T A 18: 20,032,519 H843L possibly damaging Het
F11 T C 8: 45,248,774 Y333C probably benign Het
Fbxo41 T C 6: 85,478,523 T560A possibly damaging Het
Fbxo7 A T 10: 86,044,534 H282L possibly damaging Het
Gmnc T G 16: 26,960,528 D243A probably benign Het
Hdac5 C A 11: 102,197,056 probably null Het
Krt87 A G 15: 101,436,562 V188A probably benign Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrk1 A T 7: 66,281,648 L55Q probably damaging Het
Ltbp2 C T 12: 84,813,317 C621Y probably damaging Het
March8 A G 6: 116,405,663 E147G probably damaging Het
Muc16 T G 9: 18,647,188 H2603P unknown Het
Nipa1 T A 7: 55,979,823 N181Y probably damaging Het
Olfr1281 A G 2: 111,329,112 D231G probably benign Het
Olfr297 A G 7: 86,526,912 T52A probably benign Het
Olfr562-ps1 T C 7: 102,781,787 F104L probably damaging Het
Olfr855 A G 9: 19,584,989 I151V probably benign Het
Olfr92 G A 17: 37,111,602 P127S probably damaging Het
Pcf11 T A 7: 92,657,882 Q1026L probably damaging Het
Ptch1 T G 13: 63,539,830 K378T possibly damaging Het
Ptprm C T 17: 67,353,956 probably null Het
Pxmp2 C A 5: 110,277,707 W154L possibly damaging Het
Rdh7 T G 10: 127,884,622 S294R probably damaging Het
Rexo1 C T 10: 80,544,014 R994Q possibly damaging Het
Sacs A G 14: 61,208,934 T2810A probably benign Het
Serpina3c A T 12: 104,151,721 H119Q possibly damaging Het
Slc12a2 T G 18: 57,898,128 I335R probably damaging Het
Slc25a13 C T 6: 6,073,454 R468Q probably damaging Het
Slc5a6 C T 5: 31,036,830 V628I probably benign Het
Srsf2 T C 11: 116,853,079 probably null Het
Sugp2 A G 8: 70,242,770 Q131R possibly damaging Het
Syne1 T C 10: 5,301,340 R2525G probably damaging Het
Tarsl2 T C 7: 65,678,142 F533S probably damaging Het
Tmem8b G T 4: 43,682,249 G82W probably damaging Het
Unc13c A G 9: 73,930,608 I987T possibly damaging Het
Usp44 T C 10: 93,846,489 V267A possibly damaging Het
Wac C A 18: 7,868,884 probably null Het
Zbtb38 A T 9: 96,686,654 Y792* probably null Het
Other mutations in Xkr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Xkr5 APN 8 18933498 missense probably damaging 1.00
IGL02153:Xkr5 APN 8 18933667 missense probably benign 0.09
IGL02637:Xkr5 APN 8 18934083 missense probably benign 0.00
IGL02968:Xkr5 APN 8 18933625 missense probably benign 0.13
IGL02983:Xkr5 APN 8 18933832 missense probably benign 0.00
IGL03222:Xkr5 APN 8 18937299 missense probably damaging 0.98
PIT4431001:Xkr5 UTSW 8 18934345 missense possibly damaging 0.67
R0336:Xkr5 UTSW 8 18940636 missense possibly damaging 0.93
R0638:Xkr5 UTSW 8 18933547 missense probably benign 0.00
R1644:Xkr5 UTSW 8 18934125 missense probably benign 0.03
R1703:Xkr5 UTSW 8 18939118 missense probably benign 0.15
R1777:Xkr5 UTSW 8 18939132 missense probably benign 0.33
R1972:Xkr5 UTSW 8 18941981 missense probably damaging 1.00
R3715:Xkr5 UTSW 8 18934458 missense probably benign 0.03
R4274:Xkr5 UTSW 8 18934167 missense probably benign 0.00
R4603:Xkr5 UTSW 8 18933717 missense possibly damaging 0.70
R4742:Xkr5 UTSW 8 18948730 makesense probably null
R5019:Xkr5 UTSW 8 18942110 missense probably benign 0.00
R5103:Xkr5 UTSW 8 18933643 missense probably benign 0.00
R5331:Xkr5 UTSW 8 18933468 utr 3 prime probably benign
R5649:Xkr5 UTSW 8 18933966 missense probably benign 0.00
R5883:Xkr5 UTSW 8 18940790 missense probably damaging 1.00
R6005:Xkr5 UTSW 8 18934505 missense probably benign 0.00
R6393:Xkr5 UTSW 8 18948700 missense probably damaging 1.00
R7488:Xkr5 UTSW 8 18933592 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTGGGGTTAGACATCATCC -3'
(R):5'- TTCCAGGTAGAAACTTCCGCC -3'

Sequencing Primer
(F):5'- GTGGGGTTAGACATCATCCAATCC -3'
(R):5'- GTAGAAACTTCCGCCCCAGTG -3'
Posted On2018-06-22