Incidental Mutation 'R6579:Olfr262'
ID523964
Institutional Source Beutler Lab
Gene Symbol Olfr262
Ensembl Gene ENSMUSG00000067519
Gene Nameolfactory receptor 262
SynonymsMOR214-1, GA_x6K02T2N4A9-18144-19082, MOR214-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6579 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12240721-12241659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12241362 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 100 (V100I)
Ref Sequence ENSEMBL: ENSMUSP00000085120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087818]
Predicted Effect probably benign
Transcript: ENSMUST00000087818
AA Change: V100I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085120
Gene: ENSMUSG00000067519
AA Change: V100I

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.3e-55 PFAM
Pfam:7tm_1 42 291 1.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,224 V80D possibly damaging Het
6330409D20Rik T C 2: 32,740,651 probably benign Het
Adam15 C T 3: 89,345,629 V261M probably damaging Het
Adam29 G T 8: 55,872,744 T225K probably damaging Het
Ankrd52 A G 10: 128,387,142 T654A probably damaging Het
AU021092 T A 16: 5,222,156 I35F probably damaging Het
Casc1 A T 6: 145,179,018 M527K probably benign Het
Cdk20 G T 13: 64,436,534 Q114H probably benign Het
Col22a1 A C 15: 71,881,653 S133A probably benign Het
Cyp3a44 A T 5: 145,790,706 F271Y probably damaging Het
Dchs1 A T 7: 105,762,913 V1332E probably benign Het
Dnajc5 A G 2: 181,547,416 N62D possibly damaging Het
Fam126a A T 5: 23,966,383 V347D possibly damaging Het
Gm3045 C T 13: 56,430,290 S180L probably damaging Het
Gm4756 A T 12: 72,621,884 D117E probably benign Het
Igkv14-130 T A 6: 67,791,437 Y93* probably null Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nell2 A T 15: 95,385,076 Y362N possibly damaging Het
Peli1 A T 11: 21,147,059 T150S probably benign Het
Pkhd1 T C 1: 20,200,823 T3169A probably benign Het
Polr2m T A 9: 71,485,720 E26V probably damaging Het
Rhbdf2 A G 11: 116,604,463 V238A probably benign Het
Rims1 G T 1: 22,425,916 P820H probably damaging Het
Rnf213 A G 11: 119,436,280 T1698A probably damaging Het
Scgn C T 13: 23,959,734 A216T probably damaging Het
Serpina11 T A 12: 103,984,748 D238V probably damaging Het
Setd2 A T 9: 110,549,778 E887V possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trak1 C A 9: 121,443,638 N197K probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Uchl5 T A 1: 143,798,392 Y211N probably damaging Het
Usf3 T A 16: 44,218,834 S1226T possibly damaging Het
Utrn T C 10: 12,748,006 T163A probably benign Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zcchc14 T C 8: 121,604,467 probably benign Het
Other mutations in Olfr262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr262 APN 19 12241527 missense probably damaging 0.99
IGL02170:Olfr262 APN 19 12240756 missense probably benign
IGL02748:Olfr262 APN 19 12240840 missense probably benign 0.01
IGL02896:Olfr262 APN 19 12240989 nonsense probably null
R0365:Olfr262 UTSW 19 12241076 missense probably benign 0.13
R0374:Olfr262 UTSW 19 12241141 missense probably damaging 1.00
R1226:Olfr262 UTSW 19 12241586 missense probably benign
R1319:Olfr262 UTSW 19 12241502 missense probably damaging 1.00
R1426:Olfr262 UTSW 19 12241182 missense possibly damaging 0.81
R1453:Olfr262 UTSW 19 12241592 missense probably benign
R1675:Olfr262 UTSW 19 12240831 missense probably benign 0.37
R1773:Olfr262 UTSW 19 12241659 start codon destroyed probably null 0.03
R1778:Olfr262 UTSW 19 12241455 missense probably benign
R1820:Olfr262 UTSW 19 12241248 missense probably damaging 1.00
R3161:Olfr262 UTSW 19 12241496 missense probably benign 0.06
R3412:Olfr262 UTSW 19 12241590 missense probably benign 0.00
R4387:Olfr262 UTSW 19 12241139 missense probably damaging 0.98
R4389:Olfr262 UTSW 19 12241139 missense probably damaging 0.98
R4782:Olfr262 UTSW 19 12241572 missense probably benign 0.01
R4885:Olfr262 UTSW 19 12240718 unclassified probably null
R4915:Olfr262 UTSW 19 12241373 missense probably benign 0.31
R5254:Olfr262 UTSW 19 12241248 missense probably damaging 1.00
R5726:Olfr262 UTSW 19 12241280 missense probably damaging 0.99
R7062:Olfr262 UTSW 19 12240725 missense probably benign
R7424:Olfr262 UTSW 19 12240954 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GTGCTTGATGACATTAGTTCCAC -3'
(R):5'- ACAACTCTCACCTGGAATCTGTC -3'

Sequencing Primer
(F):5'- GATGACATTAGTTCCACAAAAATGG -3'
(R):5'- GTCCCTCATTGTGTTAATAAGAATGG -3'
Posted On2018-06-22