Incidental Mutation 'R6508:Htr2b'
ID523966
Institutional Source Beutler Lab
Gene Symbol Htr2b
Ensembl Gene ENSMUSG00000026228
Gene Name5-hydroxytryptamine (serotonin) receptor 2B
Synonyms5-HT2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location86099026-86111970 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86102464 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 170 (T170A)
Ref Sequence ENSEMBL: ENSMUSP00000027431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027431] [ENSMUST00000027432] [ENSMUST00000139715] [ENSMUST00000155077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027431
AA Change: T170A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027431
Gene: ENSMUSG00000026228
AA Change: T170A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 63 394 5.9e-12 PFAM
Pfam:7tm_1 70 379 4.5e-65 PFAM
low complexity region 447 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027432
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Predicted Effect possibly damaging
Transcript: ENSMUST00000155077
AA Change: T100A

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116273
Gene: ENSMUSG00000026228
AA Change: T100A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 1 125 8.2e-8 PFAM
Pfam:7TM_GPCR_Srx 1 128 1.1e-6 PFAM
Pfam:7tm_1 1 172 6e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the several different receptors for 5-hydroxytryptamine (serotonin) that belongs to the G-protein coupled receptor 1 family. Serotonin is a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. Serotonin receptors mediate many of the central and peripheral physiologic functions of serotonin, including regulation of cardiovascular functions and impulsive behavior. Population and family-based analyses of a minor allele (glutamine-to-stop substitution, designated Q20*) which blocks expression of this protein, and knockout studies in mice, suggest a role for this gene in impulsivity. However, other factors, such as elevated testosterone levels, may also be involved. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a lack of cardiac trabeculae, ventricular hypoplasia due to impaired myocyte proliferation, and midgestational and neonatal lethality of variable severity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Htr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02434:Htr2b APN 1 86110770 missense probably benign
IGL03239:Htr2b APN 1 86099692 missense probably damaging 1.00
IGL03303:Htr2b APN 1 86099339 unclassified probably benign
P0035:Htr2b UTSW 1 86110730 missense probably benign
R0655:Htr2b UTSW 1 86110843 missense probably benign
R0748:Htr2b UTSW 1 86110806 missense probably benign 0.00
R1311:Htr2b UTSW 1 86110624 missense probably damaging 1.00
R1848:Htr2b UTSW 1 86099429 missense possibly damaging 0.90
R1916:Htr2b UTSW 1 86099801 missense probably damaging 1.00
R2938:Htr2b UTSW 1 86102455 missense possibly damaging 0.74
R4959:Htr2b UTSW 1 86100091 missense probably damaging 1.00
R6501:Htr2b UTSW 1 86110641 missense probably damaging 1.00
R6841:Htr2b UTSW 1 86099893 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CTGCTGACTTAGATTTTACTGATGG -3'
(R):5'- TGAAAGTTGCCATTCTCTGAGC -3'

Sequencing Primer
(F):5'- GCATGGCTGAGAAGCTGCAC -3'
(R):5'- GTTGCCATTCTCTGAGCAAATG -3'
Posted On2018-06-22