Incidental Mutation 'R6615:Unc13c'
ID 523967
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Name unc-13 homolog C
Synonyms D9Ertd414e, 1500037O19Rik, Munc13-3, Unc13h3
MMRRC Submission 044738-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6615 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 73386704-73876248 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73837890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 987 (I987T)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
AlphaFold Q8K0T7
Predicted Effect possibly damaging
Transcript: ENSMUST00000075245
AA Change: I987T

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: I987T

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184666
AA Change: I987T

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: I987T

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Avl9 T C 6: 56,730,870 (GRCm39) V598A probably benign Het
Bcar3 T A 3: 122,220,282 (GRCm39) S60T probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Homo
Calm3 A G 7: 16,651,508 (GRCm39) probably null Het
Ccdc113 A C 8: 96,272,620 (GRCm39) E242D probably benign Het
Celsr1 C T 15: 85,786,315 (GRCm39) probably null Het
Clhc1 T A 11: 29,528,149 (GRCm39) M559K possibly damaging Het
Dhx36 T A 3: 62,396,338 (GRCm39) I440L probably benign Het
Dnah7c A T 1: 46,554,599 (GRCm39) T445S probably benign Het
Dnah7c A G 1: 46,688,511 (GRCm39) S1894G probably benign Het
Dnah7c C A 1: 46,688,500 (GRCm39) T1890K probably benign Het
Dsc2 T A 18: 20,165,576 (GRCm39) H843L possibly damaging Het
F11 T C 8: 45,701,811 (GRCm39) Y333C probably benign Het
Fbxo41 T C 6: 85,455,505 (GRCm39) T560A possibly damaging Het
Fbxo7 A T 10: 85,880,398 (GRCm39) H282L possibly damaging Het
Gmnc T G 16: 26,779,278 (GRCm39) D243A probably benign Het
Hdac5 C A 11: 102,087,882 (GRCm39) probably null Het
Krt87 A G 15: 101,334,443 (GRCm39) V188A probably benign Het
Lpxn G A 19: 12,802,163 (GRCm39) V163M probably benign Het
Lrrk1 A T 7: 65,931,396 (GRCm39) L55Q probably damaging Het
Ltbp2 C T 12: 84,860,091 (GRCm39) C621Y probably damaging Het
Marchf8 A G 6: 116,382,624 (GRCm39) E147G probably damaging Het
Muc16 T G 9: 18,558,484 (GRCm39) H2603P unknown Het
Nipa1 T A 7: 55,629,571 (GRCm39) N181Y probably damaging Het
Nt5el T A 13: 105,248,993 (GRCm39) N402K probably damaging Het
Or14c45 A G 7: 86,176,120 (GRCm39) T52A probably benign Het
Or2h2c G A 17: 37,422,494 (GRCm39) P127S probably damaging Het
Or4k37 A G 2: 111,159,457 (GRCm39) D231G probably benign Het
Or51f23c-ps1 T C 7: 102,430,994 (GRCm39) F104L probably damaging Het
Or7g35 A G 9: 19,496,285 (GRCm39) I151V probably benign Het
Pcf11 T A 7: 92,307,090 (GRCm39) Q1026L probably damaging Het
Ptch1 T G 13: 63,687,644 (GRCm39) K378T possibly damaging Het
Ptprm C T 17: 67,660,951 (GRCm39) probably null Het
Pxmp2 C A 5: 110,425,573 (GRCm39) W154L possibly damaging Het
Rdh7 T G 10: 127,720,491 (GRCm39) S294R probably damaging Het
Rexo1 C T 10: 80,379,848 (GRCm39) R994Q possibly damaging Het
Sacs A G 14: 61,446,383 (GRCm39) T2810A probably benign Het
Serpina3c A T 12: 104,117,980 (GRCm39) H119Q possibly damaging Het
Slc12a2 T G 18: 58,031,200 (GRCm39) I335R probably damaging Het
Slc25a13 C T 6: 6,073,454 (GRCm39) R468Q probably damaging Het
Slc5a6 C T 5: 31,194,174 (GRCm39) V628I probably benign Het
Srsf2 T C 11: 116,743,905 (GRCm39) probably null Het
Sugp2 A G 8: 70,695,420 (GRCm39) Q131R possibly damaging Het
Syne1 T C 10: 5,251,340 (GRCm39) R2525G probably damaging Het
Tars3 T C 7: 65,327,890 (GRCm39) F533S probably damaging Het
Tmem8b G T 4: 43,682,249 (GRCm39) G82W probably damaging Het
Usp44 T C 10: 93,682,351 (GRCm39) V267A possibly damaging Het
Wac C A 18: 7,868,884 (GRCm39) probably null Het
Xkr5 T C 8: 18,983,569 (GRCm39) I658V probably benign Het
Zbtb38 A T 9: 96,568,707 (GRCm39) Y792* probably null Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73,643,985 (GRCm39) missense probably damaging 0.99
IGL00693:Unc13c APN 9 73,665,884 (GRCm39) missense probably benign 0.18
IGL01022:Unc13c APN 9 73,424,610 (GRCm39) missense probably benign 0.06
IGL01088:Unc13c APN 9 73,839,563 (GRCm39) missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73,840,479 (GRCm39) missense probably benign 0.05
IGL01131:Unc13c APN 9 73,471,335 (GRCm39) missense probably benign
IGL01135:Unc13c APN 9 73,392,175 (GRCm39) missense probably damaging 1.00
IGL01393:Unc13c APN 9 73,447,552 (GRCm39) missense probably benign 0.06
IGL01752:Unc13c APN 9 73,839,093 (GRCm39) missense probably benign 0.01
IGL01893:Unc13c APN 9 73,600,648 (GRCm39) missense probably benign 0.15
IGL01897:Unc13c APN 9 73,453,309 (GRCm39) missense probably damaging 0.99
IGL01936:Unc13c APN 9 73,600,524 (GRCm39) missense probably benign 0.07
IGL02122:Unc13c APN 9 73,641,679 (GRCm39) splice site probably benign
IGL02341:Unc13c APN 9 73,840,492 (GRCm39) missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73,839,910 (GRCm39) missense probably benign 0.01
IGL02545:Unc13c APN 9 73,388,357 (GRCm39) missense probably damaging 0.98
IGL02709:Unc13c APN 9 73,466,238 (GRCm39) missense probably benign 0.00
IGL02815:Unc13c APN 9 73,447,545 (GRCm39) missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73,388,349 (GRCm39) nonsense probably null
IGL03117:Unc13c APN 9 73,441,307 (GRCm39) missense probably benign 0.03
IGL03260:Unc13c APN 9 73,838,626 (GRCm39) missense probably benign 0.11
Feeling UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
Inkling UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
notion UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
BB001:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
BB011:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73,656,829 (GRCm39) missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73,391,021 (GRCm39) missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73,600,583 (GRCm39) missense probably benign 0.07
R0039:Unc13c UTSW 9 73,576,847 (GRCm39) splice site probably benign
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0308:Unc13c UTSW 9 73,388,400 (GRCm39) missense probably benign 0.04
R0344:Unc13c UTSW 9 73,838,067 (GRCm39) missense probably benign 0.39
R0421:Unc13c UTSW 9 73,840,492 (GRCm39) missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73,438,265 (GRCm39) splice site probably benign
R0655:Unc13c UTSW 9 73,838,235 (GRCm39) missense probably damaging 0.96
R1013:Unc13c UTSW 9 73,840,614 (GRCm39) missense probably benign 0.45
R1293:Unc13c UTSW 9 73,481,356 (GRCm39) missense probably benign 0.06
R1493:Unc13c UTSW 9 73,546,350 (GRCm39) missense probably benign 0.27
R1675:Unc13c UTSW 9 73,546,332 (GRCm39) critical splice donor site probably null
R1789:Unc13c UTSW 9 73,663,621 (GRCm39) missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73,390,897 (GRCm39) splice site probably null
R2055:Unc13c UTSW 9 73,643,832 (GRCm39) missense probably damaging 1.00
R2060:Unc13c UTSW 9 73,572,938 (GRCm39) missense probably damaging 0.99
R2420:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2421:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2422:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R3415:Unc13c UTSW 9 73,839,868 (GRCm39) missense probably benign 0.00
R3423:Unc13c UTSW 9 73,837,935 (GRCm39) missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73,838,240 (GRCm39) missense probably benign 0.00
R3857:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3859:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3895:Unc13c UTSW 9 73,840,805 (GRCm39) missense probably benign
R4038:Unc13c UTSW 9 73,441,188 (GRCm39) critical splice donor site probably null
R4077:Unc13c UTSW 9 73,643,821 (GRCm39) nonsense probably null
R4125:Unc13c UTSW 9 73,481,289 (GRCm39) critical splice donor site probably null
R4128:Unc13c UTSW 9 73,641,819 (GRCm39) missense probably damaging 1.00
R4235:Unc13c UTSW 9 73,438,234 (GRCm39) missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73,641,786 (GRCm39) missense probably damaging 1.00
R4307:Unc13c UTSW 9 73,600,649 (GRCm39) missense probably benign 0.06
R4658:Unc13c UTSW 9 73,840,108 (GRCm39) missense probably damaging 1.00
R4694:Unc13c UTSW 9 73,479,636 (GRCm39) missense probably benign 0.00
R4735:Unc13c UTSW 9 73,600,620 (GRCm39) missense probably benign 0.00
R4744:Unc13c UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
R4795:Unc13c UTSW 9 73,839,469 (GRCm39) missense probably damaging 0.97
R4827:Unc13c UTSW 9 73,838,568 (GRCm39) missense probably damaging 1.00
R4838:Unc13c UTSW 9 73,839,354 (GRCm39) missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73,587,716 (GRCm39) missense probably benign 0.02
R4873:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4875:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4876:Unc13c UTSW 9 73,656,821 (GRCm39) missense probably damaging 1.00
R4905:Unc13c UTSW 9 73,587,674 (GRCm39) missense probably benign
R4912:Unc13c UTSW 9 73,481,304 (GRCm39) missense probably damaging 0.99
R5026:Unc13c UTSW 9 73,838,185 (GRCm39) missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73,840,654 (GRCm39) missense probably benign 0.26
R5151:Unc13c UTSW 9 73,838,757 (GRCm39) missense probably benign 0.02
R5171:Unc13c UTSW 9 73,665,236 (GRCm39) missense probably benign
R5244:Unc13c UTSW 9 73,433,233 (GRCm39) critical splice donor site probably null
R5342:Unc13c UTSW 9 73,838,105 (GRCm39) missense probably benign 0.00
R5399:Unc13c UTSW 9 73,656,970 (GRCm39) missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73,485,672 (GRCm39) missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73,453,271 (GRCm39) missense probably benign
R5680:Unc13c UTSW 9 73,839,884 (GRCm39) missense probably damaging 1.00
R5681:Unc13c UTSW 9 73,453,357 (GRCm39) splice site probably null
R5728:Unc13c UTSW 9 73,466,238 (GRCm39) missense probably benign 0.01
R5762:Unc13c UTSW 9 73,719,649 (GRCm39) missense probably benign 0.00
R5764:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R5829:Unc13c UTSW 9 73,600,650 (GRCm39) missense probably benign 0.15
R5894:Unc13c UTSW 9 73,600,486 (GRCm39) critical splice donor site probably null
R5936:Unc13c UTSW 9 73,485,774 (GRCm39) missense probably damaging 1.00
R6043:Unc13c UTSW 9 73,643,933 (GRCm39) missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73,838,166 (GRCm39) missense probably benign
R6148:Unc13c UTSW 9 73,600,648 (GRCm39) missense probably benign 0.15
R6207:Unc13c UTSW 9 73,665,910 (GRCm39) missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73,606,451 (GRCm39) missense probably damaging 1.00
R6338:Unc13c UTSW 9 73,641,729 (GRCm39) missense probably damaging 0.99
R6978:Unc13c UTSW 9 73,839,259 (GRCm39) missense probably benign 0.39
R7053:Unc13c UTSW 9 73,839,579 (GRCm39) missense probably damaging 1.00
R7223:Unc13c UTSW 9 73,536,473 (GRCm39) missense probably benign 0.44
R7259:Unc13c UTSW 9 73,424,645 (GRCm39) missense probably benign 0.00
R7353:Unc13c UTSW 9 73,481,355 (GRCm39) missense probably benign 0.00
R7357:Unc13c UTSW 9 73,840,811 (GRCm39) small insertion probably benign
R7357:Unc13c UTSW 9 73,840,810 (GRCm39) small insertion probably benign
R7607:Unc13c UTSW 9 73,576,817 (GRCm39) missense probably damaging 0.98
R7626:Unc13c UTSW 9 73,641,799 (GRCm39) missense probably damaging 1.00
R7639:Unc13c UTSW 9 73,840,450 (GRCm39) missense probably damaging 0.99
R7657:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R7665:Unc13c UTSW 9 73,587,756 (GRCm39) missense probably benign 0.28
R7704:Unc13c UTSW 9 73,606,494 (GRCm39) missense probably benign 0.27
R7776:Unc13c UTSW 9 73,602,232 (GRCm39) missense probably damaging 1.00
R7811:Unc13c UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73,388,391 (GRCm39) missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73,840,596 (GRCm39) missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73,602,159 (GRCm39) missense probably damaging 1.00
R7924:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
R8047:Unc13c UTSW 9 73,719,636 (GRCm39) nonsense probably null
R8167:Unc13c UTSW 9 73,643,985 (GRCm39) missense probably damaging 0.99
R8202:Unc13c UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
R8210:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably benign 0.13
R8352:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8368:Unc13c UTSW 9 73,838,070 (GRCm39) missense probably benign 0.15
R8452:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8535:Unc13c UTSW 9 73,447,653 (GRCm39) missense probably benign
R8677:Unc13c UTSW 9 73,840,243 (GRCm39) missense probably benign 0.00
R8700:Unc13c UTSW 9 73,479,679 (GRCm39) missense probably benign 0.44
R8848:Unc13c UTSW 9 73,433,263 (GRCm39) missense probably benign
R8902:Unc13c UTSW 9 73,656,830 (GRCm39) missense probably damaging 0.97
R8953:Unc13c UTSW 9 73,840,044 (GRCm39) missense probably benign 0.00
R8961:Unc13c UTSW 9 73,839,524 (GRCm39) missense probably benign 0.06
R9015:Unc13c UTSW 9 73,453,322 (GRCm39) missense probably benign
R9114:Unc13c UTSW 9 73,719,665 (GRCm39) missense probably benign 0.02
R9217:Unc13c UTSW 9 73,485,715 (GRCm39) missense probably damaging 1.00
R9252:Unc13c UTSW 9 73,424,553 (GRCm39) missense possibly damaging 0.80
R9273:Unc13c UTSW 9 73,839,862 (GRCm39) missense possibly damaging 0.96
R9317:Unc13c UTSW 9 73,447,662 (GRCm39) missense possibly damaging 0.88
R9412:Unc13c UTSW 9 73,839,772 (GRCm39) missense probably benign
R9505:Unc13c UTSW 9 73,838,824 (GRCm39) missense probably benign 0.22
R9516:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably damaging 0.99
R9528:Unc13c UTSW 9 73,837,960 (GRCm39) missense possibly damaging 0.48
R9567:Unc13c UTSW 9 73,536,485 (GRCm39) missense probably damaging 0.99
R9756:Unc13c UTSW 9 73,839,526 (GRCm39) missense probably benign 0.23
R9783:Unc13c UTSW 9 73,392,227 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGTTGGGAGAGCTATCTGAAC -3'
(R):5'- TGAAACTCCTTACGAGACCCCG -3'

Sequencing Primer
(F):5'- TTGGGAGAGCTATCTGAACAAAATAG -3'
(R):5'- GCAGGCTGATGACATCATTAGTG -3'
Posted On 2018-06-22