Incidental Mutation 'R6508:Mlxipl'
ID523986
Institutional Source Beutler Lab
Gene Symbol Mlxipl
Ensembl Gene ENSMUSG00000005373
Gene NameMLX interacting protein-like
SynonymsWS-bHLH, Wbscr14, bHLHd14, ChREBP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135089890-135138382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 135128620 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 337 (A337S)
Ref Sequence ENSEMBL: ENSMUSP00000144328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005507] [ENSMUST00000128691] [ENSMUST00000129008] [ENSMUST00000142385] [ENSMUST00000153519] [ENSMUST00000201977]
Predicted Effect probably benign
Transcript: ENSMUST00000005507
AA Change: A337S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005507
Gene: ENSMUSG00000005373
AA Change: A337S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 1e-8 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
HLH 667 721 1.14e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128691
AA Change: A337S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121348
Gene: ENSMUSG00000005373
AA Change: A337S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1hloa_ 658 709 6e-7 SMART
Blast:HLH 667 699 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129008
AA Change: A337S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114933
Gene: ENSMUSG00000005373
AA Change: A337S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142385
AA Change: A337S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144328
Gene: ENSMUSG00000005373
AA Change: A337S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153519
AA Change: A337S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122198
Gene: ENSMUSG00000005373
AA Change: A337S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1am9a_ 658 696 1e-5 SMART
Blast:HLH 667 698 2e-12 BLAST
low complexity region 728 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154840
SMART Domains Protein: ENSMUSP00000121668
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
HLH 26 120 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201977
SMART Domains Protein: ENSMUSP00000144299
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 2e-6 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glycolysis and lipogenesis and severe simple carbohydrate intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Mlxipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Mlxipl APN 5 135132778 missense probably damaging 0.98
IGL01872:Mlxipl APN 5 135113691 missense probably damaging 1.00
IGL02694:Mlxipl APN 5 135124018 critical splice donor site probably null
IGL03070:Mlxipl APN 5 135132453 missense possibly damaging 0.93
Scarlet UTSW 5 135134030 missense possibly damaging 0.93
H8441:Mlxipl UTSW 5 135123961 missense probably damaging 1.00
IGL03054:Mlxipl UTSW 5 135133256 missense possibly damaging 0.83
R0003:Mlxipl UTSW 5 135133189 unclassified probably benign
R0126:Mlxipl UTSW 5 135132323 missense probably damaging 0.96
R0458:Mlxipl UTSW 5 135133370 missense probably benign 0.33
R0513:Mlxipl UTSW 5 135137263 missense probably benign 0.33
R0580:Mlxipl UTSW 5 135123975 missense probably benign 0.01
R0744:Mlxipl UTSW 5 135132475 missense possibly damaging 0.86
R0827:Mlxipl UTSW 5 135132738 missense probably benign 0.00
R1052:Mlxipl UTSW 5 135113710 missense probably damaging 1.00
R1241:Mlxipl UTSW 5 135132718 missense probably benign 0.01
R1795:Mlxipl UTSW 5 135107170 missense probably damaging 1.00
R1903:Mlxipl UTSW 5 135133568 missense possibly damaging 0.92
R2038:Mlxipl UTSW 5 135106999 missense probably damaging 1.00
R2064:Mlxipl UTSW 5 135132777 missense possibly damaging 0.77
R2069:Mlxipl UTSW 5 135107005 missense probably damaging 1.00
R2081:Mlxipl UTSW 5 135113638 missense probably damaging 1.00
R2095:Mlxipl UTSW 5 135122120 splice site probably benign
R3114:Mlxipl UTSW 5 135133662 splice site probably benign
R4018:Mlxipl UTSW 5 135132672 missense probably damaging 1.00
R4090:Mlxipl UTSW 5 135132527 missense probably benign 0.33
R4321:Mlxipl UTSW 5 135135450 nonsense probably null
R4414:Mlxipl UTSW 5 135137399 unclassified probably benign
R5706:Mlxipl UTSW 5 135133604 missense probably benign 0.33
R6088:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R6704:Mlxipl UTSW 5 135137240 critical splice acceptor site probably null
R7060:Mlxipl UTSW 5 135132315 missense possibly damaging 0.88
R7095:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R7128:Mlxipl UTSW 5 135133851 missense probably damaging 0.98
R7464:Mlxipl UTSW 5 135133628 missense probably benign 0.01
R7510:Mlxipl UTSW 5 135133118 missense possibly damaging 0.72
R7669:Mlxipl UTSW 5 135132370 missense possibly damaging 0.53
R7737:Mlxipl UTSW 5 135135381 missense possibly damaging 0.73
R7806:Mlxipl UTSW 5 135134543 missense possibly damaging 0.93
R7910:Mlxipl UTSW 5 135132409 missense possibly damaging 0.85
R7991:Mlxipl UTSW 5 135132409 missense possibly damaging 0.85
R8118:Mlxipl UTSW 5 135137248 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCTCTTGTAGAAGCCTTCCAC -3'
(R):5'- TGGTTGGCCCAGTAAATGTC -3'

Sequencing Primer
(F):5'- AACCTCTCCAGTGTGGGAACTG -3'
(R):5'- GTTGGCCCAGTAAATGTCTTTTTAC -3'
Posted On2018-06-22