Incidental Mutation 'R6615:Ptch1'
ID523987
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Namepatched 1
SynonymsA230106A15Rik, Patched 1, Ptc1, Ptc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6615 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location63508328-63573598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 63539830 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 378 (K378T)
Ref Sequence ENSEMBL: ENSMUSP00000141489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000193953] [ENSMUST00000194663] [ENSMUST00000195106] [ENSMUST00000195258] [ENSMUST00000195756]
Predicted Effect probably benign
Transcript: ENSMUST00000021921
AA Change: K515T

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: K515T

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192155
AA Change: K378T

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: K378T

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193953
Predicted Effect probably benign
Transcript: ENSMUST00000194663
AA Change: K463T

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466
AA Change: K463T

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195106
SMART Domains Protein: ENSMUSP00000141298
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
low complexity region 38 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195258
AA Change: K408T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466
AA Change: K408T

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223515
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,112,485 N402K probably damaging Het
Avl9 T C 6: 56,753,885 V598A probably benign Het
Bcar3 T A 3: 122,426,633 S60T probably benign Het
Bean1 CT C 8: 104,182,032 probably null Homo
Calm3 A G 7: 16,917,583 probably null Het
Ccdc113 A C 8: 95,545,992 E242D probably benign Het
Celsr1 C T 15: 85,902,114 probably null Het
Clhc1 T A 11: 29,578,149 M559K possibly damaging Het
Dhx36 T A 3: 62,488,917 I440L probably benign Het
Dnah7c A T 1: 46,515,439 T445S probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dsc2 T A 18: 20,032,519 H843L possibly damaging Het
F11 T C 8: 45,248,774 Y333C probably benign Het
Fbxo41 T C 6: 85,478,523 T560A possibly damaging Het
Fbxo7 A T 10: 86,044,534 H282L possibly damaging Het
Gmnc T G 16: 26,960,528 D243A probably benign Het
Hdac5 C A 11: 102,197,056 probably null Het
Krt87 A G 15: 101,436,562 V188A probably benign Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrk1 A T 7: 66,281,648 L55Q probably damaging Het
Ltbp2 C T 12: 84,813,317 C621Y probably damaging Het
March8 A G 6: 116,405,663 E147G probably damaging Het
Muc16 T G 9: 18,647,188 H2603P unknown Het
Nipa1 T A 7: 55,979,823 N181Y probably damaging Het
Olfr1281 A G 2: 111,329,112 D231G probably benign Het
Olfr297 A G 7: 86,526,912 T52A probably benign Het
Olfr562-ps1 T C 7: 102,781,787 F104L probably damaging Het
Olfr855 A G 9: 19,584,989 I151V probably benign Het
Olfr92 G A 17: 37,111,602 P127S probably damaging Het
Pcf11 T A 7: 92,657,882 Q1026L probably damaging Het
Ptprm C T 17: 67,353,956 probably null Het
Pxmp2 C A 5: 110,277,707 W154L possibly damaging Het
Rdh7 T G 10: 127,884,622 S294R probably damaging Het
Rexo1 C T 10: 80,544,014 R994Q possibly damaging Het
Sacs A G 14: 61,208,934 T2810A probably benign Het
Serpina3c A T 12: 104,151,721 H119Q possibly damaging Het
Slc12a2 T G 18: 57,898,128 I335R probably damaging Het
Slc25a13 C T 6: 6,073,454 R468Q probably damaging Het
Slc5a6 C T 5: 31,036,830 V628I probably benign Het
Srsf2 T C 11: 116,853,079 probably null Het
Sugp2 A G 8: 70,242,770 Q131R possibly damaging Het
Syne1 T C 10: 5,301,340 R2525G probably damaging Het
Tarsl2 T C 7: 65,678,142 F533S probably damaging Het
Tmem8b G T 4: 43,682,249 G82W probably damaging Het
Unc13c A G 9: 73,930,608 I987T possibly damaging Het
Usp44 T C 10: 93,846,489 V267A possibly damaging Het
Wac C A 18: 7,868,884 probably null Het
Xkr5 T C 8: 18,933,553 I658V probably benign Het
Zbtb38 A T 9: 96,686,654 Y792* probably null Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4035:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63523164 missense probably benign 0.02
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63523004 missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5604:Ptch1 UTSW 13 63525122 missense probably benign 0.01
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5945:Ptch1 UTSW 13 63573419 utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63511736 missense probably benign 0.23
R7168:Ptch1 UTSW 13 63512060 missense probably benign
R7257:Ptch1 UTSW 13 63573294 missense not run
R7258:Ptch1 UTSW 13 63573294 missense not run
R7259:Ptch1 UTSW 13 63573294 missense not run
R7368:Ptch1 UTSW 13 63511984 missense probably benign 0.06
R7525:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7528:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7820:Ptch1 UTSW 13 63523061 missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63540812 missense probably damaging 0.98
Z1177:Ptch1 UTSW 13 63520279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCTGGGAACATGAAGC -3'
(R):5'- TATCCACCAAATTGGCATAAGC -3'

Sequencing Primer
(F):5'- CTGGGAACATGAAGCATTCTGCC -3'
(R):5'- AAATTGGCATAAGCTCCCCCTTG -3'
Posted On2018-06-22