Incidental Mutation 'R6508:Vmn1r73'
ID523993
Institutional Source Beutler Lab
Gene Symbol Vmn1r73
Ensembl Gene ENSMUSG00000051687
Gene Namevomeronasal 1 receptor 73
SynonymsV1rg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location11730266-11762081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11756704 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 150 (V150I)
Ref Sequence ENSEMBL: ENSMUSP00000153827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055070] [ENSMUST00000226516]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055070
AA Change: V150I

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055353
Gene: ENSMUSG00000051687
AA Change: V150I

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 7.5e-7 PFAM
Pfam:V1R 32 297 1.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226516
AA Change: V150I

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Vmn1r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Vmn1r73 APN 7 11756738 missense probably benign 0.02
IGL02337:Vmn1r73 APN 7 11756713 missense possibly damaging 0.69
IGL02666:Vmn1r73 APN 7 11756938 missense probably damaging 1.00
IGL02741:Vmn1r73 APN 7 11756783 missense probably benign 0.05
IGL02756:Vmn1r73 APN 7 11756647 missense possibly damaging 0.95
IGL03113:Vmn1r73 APN 7 11756600 missense probably benign
IGL03195:Vmn1r73 APN 7 11757080 missense probably damaging 1.00
R0023:Vmn1r73 UTSW 7 11757070 missense probably benign 0.43
R0379:Vmn1r73 UTSW 7 11756846 missense probably benign 0.16
R3941:Vmn1r73 UTSW 7 11756755 missense probably damaging 1.00
R4224:Vmn1r73 UTSW 7 11756579 missense probably damaging 0.99
R4631:Vmn1r73 UTSW 7 11756831 missense probably benign 0.22
R4912:Vmn1r73 UTSW 7 11756669 missense probably damaging 0.99
R5060:Vmn1r73 UTSW 7 11756756 missense probably damaging 1.00
R5450:Vmn1r73 UTSW 7 11756449 missense possibly damaging 0.63
R5609:Vmn1r73 UTSW 7 11756664 nonsense probably null
R6059:Vmn1r73 UTSW 7 11756611 missense probably benign 0.40
R6967:Vmn1r73 UTSW 7 11756617 nonsense probably null
R7099:Vmn1r73 UTSW 7 11756393 missense probably damaging 1.00
R7304:Vmn1r73 UTSW 7 11756897 missense probably damaging 1.00
R7579:Vmn1r73 UTSW 7 11757155 missense probably benign 0.08
R7891:Vmn1r73 UTSW 7 11757109 missense possibly damaging 0.87
R7974:Vmn1r73 UTSW 7 11757109 missense possibly damaging 0.87
Z1176:Vmn1r73 UTSW 7 11756956 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAATGTCCCTGTATTCAATGTG -3'
(R):5'- GCTCTGTTTTCAGGTGAAGC -3'

Sequencing Primer
(F):5'- GCATACTGAGTTGCTTCCAAG -3'
(R):5'- TGTCTGTAGAGAATACTCACCATGG -3'
Posted On2018-06-22