Incidental Mutation 'R6615:Krt87'
ID523994
Institutional Source Beutler Lab
Gene Symbol Krt87
Ensembl Gene ENSMUSG00000047641
Gene Namekeratin 87
SynonymsKrt83, Krt2-25
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6615 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101431038-101438804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101436562 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000080613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081945]
Predicted Effect probably benign
Transcript: ENSMUST00000081945
AA Change: V188A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000080613
Gene: ENSMUSG00000047641
AA Change: V188A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 3 107 1e-12 PFAM
Filament 110 421 6.45e-148 SMART
low complexity region 425 440 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,112,485 N402K probably damaging Het
Avl9 T C 6: 56,753,885 V598A probably benign Het
Bcar3 T A 3: 122,426,633 S60T probably benign Het
Bean1 CT C 8: 104,182,032 probably null Homo
Calm3 A G 7: 16,917,583 probably null Het
Ccdc113 A C 8: 95,545,992 E242D probably benign Het
Celsr1 C T 15: 85,902,114 probably null Het
Clhc1 T A 11: 29,578,149 M559K possibly damaging Het
Dhx36 T A 3: 62,488,917 I440L probably benign Het
Dnah7c A T 1: 46,515,439 T445S probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dsc2 T A 18: 20,032,519 H843L possibly damaging Het
F11 T C 8: 45,248,774 Y333C probably benign Het
Fbxo41 T C 6: 85,478,523 T560A possibly damaging Het
Fbxo7 A T 10: 86,044,534 H282L possibly damaging Het
Gmnc T G 16: 26,960,528 D243A probably benign Het
Hdac5 C A 11: 102,197,056 probably null Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrk1 A T 7: 66,281,648 L55Q probably damaging Het
Ltbp2 C T 12: 84,813,317 C621Y probably damaging Het
March8 A G 6: 116,405,663 E147G probably damaging Het
Muc16 T G 9: 18,647,188 H2603P unknown Het
Nipa1 T A 7: 55,979,823 N181Y probably damaging Het
Olfr1281 A G 2: 111,329,112 D231G probably benign Het
Olfr297 A G 7: 86,526,912 T52A probably benign Het
Olfr562-ps1 T C 7: 102,781,787 F104L probably damaging Het
Olfr855 A G 9: 19,584,989 I151V probably benign Het
Olfr92 G A 17: 37,111,602 P127S probably damaging Het
Pcf11 T A 7: 92,657,882 Q1026L probably damaging Het
Ptch1 T G 13: 63,539,830 K378T possibly damaging Het
Ptprm C T 17: 67,353,956 probably null Het
Pxmp2 C A 5: 110,277,707 W154L possibly damaging Het
Rdh7 T G 10: 127,884,622 S294R probably damaging Het
Rexo1 C T 10: 80,544,014 R994Q possibly damaging Het
Sacs A G 14: 61,208,934 T2810A probably benign Het
Serpina3c A T 12: 104,151,721 H119Q possibly damaging Het
Slc12a2 T G 18: 57,898,128 I335R probably damaging Het
Slc25a13 C T 6: 6,073,454 R468Q probably damaging Het
Slc5a6 C T 5: 31,036,830 V628I probably benign Het
Srsf2 T C 11: 116,853,079 probably null Het
Sugp2 A G 8: 70,242,770 Q131R possibly damaging Het
Syne1 T C 10: 5,301,340 R2525G probably damaging Het
Tarsl2 T C 7: 65,678,142 F533S probably damaging Het
Tmem8b G T 4: 43,682,249 G82W probably damaging Het
Unc13c A G 9: 73,930,608 I987T possibly damaging Het
Usp44 T C 10: 93,846,489 V267A possibly damaging Het
Wac C A 18: 7,868,884 probably null Het
Xkr5 T C 8: 18,933,553 I658V probably benign Het
Zbtb38 A T 9: 96,686,654 Y792* probably null Het
Other mutations in Krt87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Krt87 APN 15 101438446 missense probably benign 0.00
IGL01019:Krt87 APN 15 101438431 missense possibly damaging 0.84
IGL01066:Krt87 APN 15 101438385 critical splice donor site probably null
IGL01087:Krt87 APN 15 101431825 missense probably benign 0.27
IGL01572:Krt87 APN 15 101436533 missense probably benign 0.33
IGL02716:Krt87 APN 15 101434604 missense possibly damaging 0.52
IGL03287:Krt87 APN 15 101432337 splice site probably benign
R0144:Krt87 UTSW 15 101438661 missense probably benign 0.04
R2196:Krt87 UTSW 15 101438433 missense probably damaging 0.99
R2209:Krt87 UTSW 15 101433108 missense probably benign 0.42
R5651:Krt87 UTSW 15 101434029 missense possibly damaging 0.94
R6437:Krt87 UTSW 15 101438392 missense possibly damaging 0.95
R6680:Krt87 UTSW 15 101433978 missense probably damaging 1.00
R7541:Krt87 UTSW 15 101438634 missense probably damaging 1.00
R7617:Krt87 UTSW 15 101438545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTTCAGTCTAGAAGAAAACTCCCAC -3'
(R):5'- TTCCTGGAGCAGCAGAACAAG -3'

Sequencing Primer
(F):5'- ACATCAGATATCCTGCATGTCAG -3'
(R):5'- GCTGCTGGAGACCAAGTG -3'
Posted On2018-06-22