Incidental Mutation 'R6508:Spata4'
ID523997
Institutional Source Beutler Lab
Gene Symbol Spata4
Ensembl Gene ENSMUSG00000031518
Gene Namespermatogenesis associated 4
Synonyms1700001N01Rik, SRG2, TSARG2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location54600781-54610098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54600852 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 18 (S18P)
Ref Sequence ENSEMBL: ENSMUSP00000033917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033917]
Predicted Effect probably benign
Transcript: ENSMUST00000033917
AA Change: S18P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033917
Gene: ENSMUSG00000031518
AA Change: S18P

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
Pfam:CH_2 54 149 1.1e-37 PFAM
Pfam:CAMSAP_CH 56 136 2.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162770
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Spata4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Spata4 APN 8 54602306 splice site probably benign
IGL02418:Spata4 APN 8 54609943 missense probably benign 0.00
IGL02685:Spata4 APN 8 54600928 missense probably benign 0.02
IGL03172:Spata4 APN 8 54602405 missense probably benign 0.00
R0885:Spata4 UTSW 8 54600844 missense probably damaging 0.98
R2237:Spata4 UTSW 8 54602629 missense probably benign 0.06
R2238:Spata4 UTSW 8 54602629 missense probably benign 0.06
R2239:Spata4 UTSW 8 54602629 missense probably benign 0.06
R4430:Spata4 UTSW 8 54601843 missense probably benign 0.03
R4915:Spata4 UTSW 8 54602436 splice site probably null
R6809:Spata4 UTSW 8 54602333 missense possibly damaging 0.82
R7148:Spata4 UTSW 8 54602550 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GACTGTTAACGTTCATGGATCC -3'
(R):5'- AGCACCTGGTGACATTCCTAG -3'

Sequencing Primer
(F):5'- TGGATCCAGAGATTACTGACTCC -3'
(R):5'- CACCTGGTGACATTCCTAGGGAAG -3'
Posted On2018-06-22