Mutagenetix > Incidental Mutation

Incidental Mutation 'R6508:Tll1'

523999

Institutional Source

Beutler Lab

Gene Symbol

Tll1

Ensembl Gene

ENSMUSG00000053626

Gene Name

tolloid-like

Synonyms

Tll-1, b2b2476Clo

MMRRC Submission

044638-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6508 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64467965-64659305 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 64551494 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 296 (I296L)

Ref Sequence

ENSEMBL: ENSMUSP00000070560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066166]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000066166
AA Change: I296L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: I296L

Domain	Start	End	E-Value	Type
ZnMc	153	295	4.12e-56	SMART
CUB	349	461	4.12e-44	SMART
CUB	462	574	3.81e-48	SMART
EGF_CA	574	615	2.28e-9	SMART
CUB	618	730	9.11e-46	SMART
EGF_CA	730	770	4.25e-9	SMART
CUB	774	886	2.01e-47	SMART
CUB	887	1003	7.19e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209451

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4fm2	G	A	4: 144,291,590 (GRCm39)	R39*	probably null	Het
Brca2	A	T	5: 150,460,058 (GRCm39)	E444D	possibly damaging	Het
Camkk2	G	T	5: 122,884,382 (GRCm39)	N346K	probably damaging	Het
Car4	C	A	11: 84,856,469 (GRCm39)	D252E	possibly damaging	Het
Chd1	A	G	17: 15,958,895 (GRCm39)	K649R	probably benign	Het
Col12a1	A	G	9: 79,557,231 (GRCm39)	Y1966H	probably damaging	Het
Crppa	C	T	12: 36,476,298 (GRCm39)	A180V	possibly damaging	Het
Cts6	T	A	13: 61,344,221 (GRCm39)	H277L	probably damaging	Het
Dcc	G	T	18: 71,439,144 (GRCm39)	P1246Q	probably damaging	Het
Dlg5	G	A	14: 24,188,774 (GRCm39)	T1739I	probably benign	Het
Eci1	T	A	17: 24,656,283 (GRCm39)	N164K	probably damaging	Het
Entpd7	G	A	19: 43,679,525 (GRCm39)	R26H	probably damaging	Het
Fanci	A	G	7: 79,093,516 (GRCm39)	K1008E	probably damaging	Het
Htr2b	T	C	1: 86,030,186 (GRCm39)	T170A	possibly damaging	Het
Irgm2	A	G	11: 58,110,327 (GRCm39)	E18G	probably benign	Het
Kdm1a	A	T	4: 136,281,621 (GRCm39)	V630E	probably damaging	Het
Keap1	G	A	9: 21,143,010 (GRCm39)	T501I	possibly damaging	Het
L3mbtl3	T	A	10: 26,194,325 (GRCm39)	H424L	unknown	Het
Lrrc14b	C	T	13: 74,511,337 (GRCm39)	D248N	possibly damaging	Het
Macf1	T	A	4: 123,363,535 (GRCm39)	D3364V	probably damaging	Het
Map3k20	G	A	2: 72,272,253 (GRCm39)	G794S	probably benign	Het
Mcat	T	C	15: 83,433,452 (GRCm39)	Q34R	probably benign	Het
Mettl4	T	C	17: 95,051,373 (GRCm39)	E148G	probably damaging	Het
Mgat3	T	C	15: 80,096,225 (GRCm39)	S351P	possibly damaging	Het
Mllt1	A	T	17: 57,234,054 (GRCm39)	I44N	probably damaging	Het
Mlxipl	G	T	5: 135,157,474 (GRCm39)	A337S	probably benign	Het
Naip1	A	G	13: 100,572,973 (GRCm39)	F254L	probably damaging	Het
Obscn	A	T	11: 58,944,973 (GRCm39)		probably null	Het
Or10q1	C	T	19: 13,726,718 (GRCm39)	P83S	probably damaging	Het
Pcdh12	G	A	18: 38,414,390 (GRCm39)	R912*	probably null	Het
Pcdh17	A	G	14: 84,685,419 (GRCm39)	N629D	probably damaging	Het
Pcnx1	T	C	12: 81,959,479 (GRCm39)	I170T	probably damaging	Het
Pgr	A	G	9: 8,956,290 (GRCm39)	Y746C	probably damaging	Het
Pramel29	A	T	4: 143,934,171 (GRCm39)	L312*	probably null	Het
Pum2	T	C	12: 8,798,861 (GRCm39)	Y991H	probably benign	Het
Rcc1l	A	T	5: 134,198,077 (GRCm39)	V185D	probably damaging	Het
Scarb1	A	T	5: 125,381,389 (GRCm39)	S52T	possibly damaging	Het
Smc1b	C	T	15: 84,976,232 (GRCm39)	R825Q	probably benign	Het
Spata4	T	C	8: 55,053,887 (GRCm39)	S18P	probably benign	Het
Stard13	G	A	5: 150,986,754 (GRCm39)	T134I	probably benign	Het
Tbc1d32	C	T	10: 56,100,786 (GRCm39)	C64Y	probably damaging	Het
Tmem229b	T	G	12: 79,011,680 (GRCm39)	T84P	probably damaging	Het
Ttn	T	C	2: 76,544,757 (GRCm39)	T32782A	possibly damaging	Het
Vmn1r73	G	A	7: 11,490,631 (GRCm39)	V150I	possibly damaging	Het
Vmn2r80	T	A	10: 79,030,290 (GRCm39)	F705L	probably benign	Het

Other mutations in Tll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tll1	APN	8	64,469,170 (GRCm39)	missense	probably benign
IGL00583:Tll1	APN	8	64,658,326 (GRCm39)	missense	probably benign
IGL00767:Tll1	APN	8	64,524,355 (GRCm39)	missense	probably damaging	1.00
IGL01061:Tll1	APN	8	64,491,488 (GRCm39)	critical splice donor site	probably null
IGL01077:Tll1	APN	8	64,523,266 (GRCm39)	missense	probably benign	0.27
IGL01536:Tll1	APN	8	64,527,323 (GRCm39)	missense	probably damaging	1.00
IGL02137:Tll1	APN	8	64,469,132 (GRCm39)	missense	possibly damaging	0.73
IGL02168:Tll1	APN	8	64,507,001 (GRCm39)	missense	possibly damaging	0.50
IGL02378:Tll1	APN	8	64,470,660 (GRCm39)	nonsense	probably null
IGL02469:Tll1	APN	8	64,523,314 (GRCm39)	missense	probably benign	0.41
IGL02504:Tll1	APN	8	64,523,271 (GRCm39)	missense	possibly damaging	0.55
IGL02650:Tll1	APN	8	64,500,031 (GRCm39)	splice site	probably benign
IGL02937:Tll1	APN	8	64,658,319 (GRCm39)	nonsense	probably null
IGL03006:Tll1	APN	8	64,527,251 (GRCm39)	splice site	probably benign
R0518:Tll1	UTSW	8	64,551,505 (GRCm39)	missense	probably damaging	1.00
R0521:Tll1	UTSW	8	64,551,505 (GRCm39)	missense	probably damaging	1.00
R0541:Tll1	UTSW	8	64,491,486 (GRCm39)	splice site	probably null
R0612:Tll1	UTSW	8	64,524,344 (GRCm39)	missense	possibly damaging	0.91
R0690:Tll1	UTSW	8	64,527,324 (GRCm39)	missense	probably damaging	0.99
R0738:Tll1	UTSW	8	64,554,984 (GRCm39)	missense	probably damaging	1.00
R1454:Tll1	UTSW	8	64,491,524 (GRCm39)	missense	probably benign
R1619:Tll1	UTSW	8	64,509,307 (GRCm39)	missense	probably benign	0.25
R1625:Tll1	UTSW	8	64,494,476 (GRCm39)	missense	probably damaging	1.00
R1654:Tll1	UTSW	8	64,570,937 (GRCm39)	critical splice donor site	probably null
R1663:Tll1	UTSW	8	64,470,720 (GRCm39)	missense	probably benign	0.08
R1681:Tll1	UTSW	8	64,538,585 (GRCm39)	missense	possibly damaging	0.93
R1713:Tll1	UTSW	8	64,554,907 (GRCm39)	missense	probably damaging	0.99
R1908:Tll1	UTSW	8	64,478,141 (GRCm39)	missense	probably damaging	0.98
R2118:Tll1	UTSW	8	64,538,591 (GRCm39)	missense	probably benign	0.21
R2121:Tll1	UTSW	8	64,538,591 (GRCm39)	missense	probably benign	0.21
R2124:Tll1	UTSW	8	64,538,591 (GRCm39)	missense	probably benign	0.21
R2360:Tll1	UTSW	8	64,504,435 (GRCm39)	missense	probably damaging	1.00
R2396:Tll1	UTSW	8	64,523,324 (GRCm39)	nonsense	probably null
R3032:Tll1	UTSW	8	64,551,526 (GRCm39)	missense	probably damaging	0.96
R3115:Tll1	UTSW	8	64,506,900 (GRCm39)	missense	probably damaging	1.00
R3889:Tll1	UTSW	8	64,658,258 (GRCm39)	missense	possibly damaging	0.77
R4126:Tll1	UTSW	8	64,571,048 (GRCm39)	missense	possibly damaging	0.78
R4182:Tll1	UTSW	8	64,494,545 (GRCm39)	missense	probably damaging	1.00
R4572:Tll1	UTSW	8	64,509,343 (GRCm39)	missense	possibly damaging	0.81
R4677:Tll1	UTSW	8	64,504,411 (GRCm39)	missense	probably benign	0.31
R4811:Tll1	UTSW	8	64,538,507 (GRCm39)	missense	possibly damaging	0.72
R4904:Tll1	UTSW	8	64,523,233 (GRCm39)	missense	probably benign	0.00
R4992:Tll1	UTSW	8	64,546,978 (GRCm39)	missense	probably damaging	0.98
R5061:Tll1	UTSW	8	64,506,983 (GRCm39)	missense	probably damaging	0.99
R5078:Tll1	UTSW	8	64,546,921 (GRCm39)	missense	probably damaging	1.00
R5208:Tll1	UTSW	8	64,504,527 (GRCm39)	missense	probably damaging	0.99
R5283:Tll1	UTSW	8	64,555,000 (GRCm39)	missense	possibly damaging	0.68
R5399:Tll1	UTSW	8	64,538,522 (GRCm39)	missense	probably damaging	1.00
R5699:Tll1	UTSW	8	64,570,974 (GRCm39)	missense	probably damaging	0.98
R5986:Tll1	UTSW	8	64,527,297 (GRCm39)	missense	probably damaging	0.99
R6019:Tll1	UTSW	8	64,494,525 (GRCm39)	missense	possibly damaging	0.83
R6046:Tll1	UTSW	8	64,506,925 (GRCm39)	nonsense	probably null
R6083:Tll1	UTSW	8	64,491,620 (GRCm39)	splice site	probably null
R6125:Tll1	UTSW	8	64,504,521 (GRCm39)	missense	probably damaging	1.00
R6222:Tll1	UTSW	8	64,551,568 (GRCm39)	missense	probably benign	0.18
R6275:Tll1	UTSW	8	64,504,401 (GRCm39)	nonsense	probably null
R6758:Tll1	UTSW	8	64,494,439 (GRCm39)	critical splice donor site	probably null
R6782:Tll1	UTSW	8	64,524,315 (GRCm39)	missense	probably benign	0.00
R6848:Tll1	UTSW	8	64,551,544 (GRCm39)	missense	probably damaging	0.99
R7057:Tll1	UTSW	8	64,554,915 (GRCm39)	missense	probably damaging	1.00
R7144:Tll1	UTSW	8	64,577,979 (GRCm39)	missense	possibly damaging	0.90
R7244:Tll1	UTSW	8	64,478,222 (GRCm39)	missense	probably benign	0.00
R7336:Tll1	UTSW	8	64,478,176 (GRCm39)	missense	probably damaging	0.98
R7373:Tll1	UTSW	8	64,504,391 (GRCm39)	missense	probably damaging	0.98
R7626:Tll1	UTSW	8	64,551,268 (GRCm39)	splice site	probably null
R7687:Tll1	UTSW	8	64,574,526 (GRCm39)	nonsense	probably null
R7699:Tll1	UTSW	8	64,546,988 (GRCm39)	missense	probably benign	0.00
R7700:Tll1	UTSW	8	64,546,988 (GRCm39)	missense	probably benign	0.00
R7765:Tll1	UTSW	8	64,504,483 (GRCm39)	missense	probably damaging	1.00
R7790:Tll1	UTSW	8	64,478,271 (GRCm39)	nonsense	probably null
R7954:Tll1	UTSW	8	64,571,568 (GRCm39)	missense	probably damaging	1.00
R8710:Tll1	UTSW	8	64,577,940 (GRCm39)	missense	possibly damaging	0.77
R8792:Tll1	UTSW	8	64,538,499 (GRCm39)	missense	probably damaging	1.00
R9134:Tll1	UTSW	8	64,469,201 (GRCm39)	missense	possibly damaging	0.91
R9444:Tll1	UTSW	8	64,469,123 (GRCm39)	missense	probably damaging	1.00
R9539:Tll1	UTSW	8	64,494,457 (GRCm39)	missense	probably damaging	1.00
X0020:Tll1	UTSW	8	64,470,662 (GRCm39)	missense	probably damaging	0.97
Z1176:Tll1	UTSW	8	64,500,197 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGGCTTGCCAATTTAATAGGC -3'
(R):5'- GACTTAGGACATATGGATTTGCTTC -3'

Sequencing Primer
(F):5'- CCAATTTAATAGGCTGAGTGGC -3'
(R):5'- CGGACACTTAGGTCAAGAG -3'

Posted On

2018-06-22