Incidental Mutation 'R6508:Irgm2'
ID524011
Institutional Source Beutler Lab
Gene Symbol Irgm2
Ensembl Gene ENSMUSG00000069874
Gene Nameimmunity-related GTPase family M member 2
SynonymsGtpi, Iigp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58199618-58222782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58219501 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 18 (E18G)
Ref Sequence ENSEMBL: ENSMUSP00000146805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058704] [ENSMUST00000108836] [ENSMUST00000209079]
Predicted Effect probably benign
Transcript: ENSMUST00000058704
AA Change: E6G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056001
Gene: ENSMUSG00000069874
AA Change: E6G

DomainStartEndE-ValueType
Pfam:IIGP 30 387 8.1e-165 PFAM
Pfam:MMR_HSR1 66 179 9.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108836
AA Change: E6G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104464
Gene: ENSMUSG00000069874
AA Change: E6G

DomainStartEndE-ValueType
Pfam:IIGP 30 387 4.9e-164 PFAM
Pfam:MMR_HSR1 66 179 2.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209079
AA Change: E18G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the p47 immunity-related GTPase family. The encoded protein may play a role in the innate immune response by regulating autophagy formation in response to intracellular pathogens. Polymorphisms that affect the normal expression of this gene are associated with a susceptibility to Crohn's disease and tuberculosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Irgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Irgm2 APN 11 58220341 missense probably benign 0.00
IGL01933:Irgm2 APN 11 58219957 missense possibly damaging 0.95
IGL02115:Irgm2 APN 11 58220122 missense probably benign 0.21
IGL02398:Irgm2 APN 11 58219929 missense probably damaging 1.00
IGL02708:Irgm2 APN 11 58220524 missense probably benign 0.00
IGL02730:Irgm2 APN 11 58219990 missense probably benign 0.26
R0282:Irgm2 UTSW 11 58219519 missense probably benign 0.00
R1621:Irgm2 UTSW 11 58220538 missense probably benign
R1717:Irgm2 UTSW 11 58220635 missense probably damaging 1.00
R1980:Irgm2 UTSW 11 58220076 missense probably damaging 0.99
R1986:Irgm2 UTSW 11 58219558 missense probably benign 0.00
R2145:Irgm2 UTSW 11 58220529 missense possibly damaging 0.90
R2184:Irgm2 UTSW 11 58220428 missense probably benign 0.01
R2327:Irgm2 UTSW 11 58220392 missense probably damaging 1.00
R4041:Irgm2 UTSW 11 58220130 missense probably benign 0.00
R4231:Irgm2 UTSW 11 58219478 start gained probably benign
R5988:Irgm2 UTSW 11 58220187 missense probably benign 0.39
R6143:Irgm2 UTSW 11 58220609 missense possibly damaging 0.55
R6528:Irgm2 UTSW 11 58220052 missense probably benign 0.10
R6851:Irgm2 UTSW 11 58219815 missense possibly damaging 0.95
R7351:Irgm2 UTSW 11 58219605 missense possibly damaging 0.93
R7434:Irgm2 UTSW 11 58219465 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTCCAAGAAAGTGCGCATG -3'
(R):5'- ACATGCCATTGCCAGAGTC -3'

Sequencing Primer
(F):5'- CATGCACAGGAGGGCTCAG -3'
(R):5'- ATTGCCAGAGTCCCCAGTC -3'
Posted On2018-06-22