Incidental Mutation 'R6616:Alpi'
ID524012
Institutional Source Beutler Lab
Gene Symbol Alpi
Ensembl Gene ENSMUSG00000079440
Gene Namealkaline phosphatase, intestinal
Synonyms2010001C14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87098002-87101606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87101114 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 74 (I74V)
Ref Sequence ENSEMBL: ENSMUSP00000108895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113270]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113270
AA Change: I74V

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108895
Gene: ENSMUSG00000079440
AA Change: I74V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
alkPPc 54 489 7.97e-247 SMART
low complexity region 509 532 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186823
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an alkaline phosphatase, a metalloenzyme that catalyzes the hydrolysis of phosphoric acid monoesters. It belongs to a multigene family composed of four alkaline phosphatase isoenzymes. The enzyme functions as a homodimer and has a catalytic site containing one magnesium and two zinc ions, which are required for its enzymatic function. The protein is primarily expressed in placental and endometrial tissue; however, strong ectopic expression has been detected in ovarian adenocarcinoma, serous cystadenocarcinoma, and other ovarian cancer cells. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Alpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Alpi APN 1 87099720 missense probably damaging 1.00
IGL01972:Alpi APN 1 87099709 missense probably damaging 1.00
IGL02672:Alpi APN 1 87101272 missense probably damaging 1.00
IGL03089:Alpi APN 1 87100108 missense probably benign 0.05
IGL03099:Alpi APN 1 87098631 missense unknown
IGL03154:Alpi APN 1 87100088 missense probably damaging 1.00
IGL03372:Alpi APN 1 87100628 splice site probably benign
K7371:Alpi UTSW 1 87099171 splice site probably benign
R0053:Alpi UTSW 1 87098790 missense probably benign 0.03
R0054:Alpi UTSW 1 87099765 missense possibly damaging 0.61
R0070:Alpi UTSW 1 87101159 splice site probably benign
R1586:Alpi UTSW 1 87100201 missense probably damaging 1.00
R1835:Alpi UTSW 1 87099414 missense possibly damaging 0.88
R2372:Alpi UTSW 1 87100594 missense probably damaging 1.00
R4546:Alpi UTSW 1 87099117 missense probably damaging 1.00
R4861:Alpi UTSW 1 87100469 missense probably damaging 0.98
R4861:Alpi UTSW 1 87100469 missense probably damaging 0.98
R4968:Alpi UTSW 1 87101525 missense probably benign 0.05
R5427:Alpi UTSW 1 87101354 missense probably benign 0.04
R6245:Alpi UTSW 1 87100834 missense probably damaging 1.00
R6394:Alpi UTSW 1 87100706 missense possibly damaging 0.71
R6398:Alpi UTSW 1 87099462 missense probably damaging 0.98
R7168:Alpi UTSW 1 87099433 missense possibly damaging 0.94
R7448:Alpi UTSW 1 87101535 start codon destroyed possibly damaging 0.79
R7473:Alpi UTSW 1 87099647 critical splice donor site probably null
R7527:Alpi UTSW 1 87098955 missense probably benign 0.01
R7552:Alpi UTSW 1 87099073 missense probably benign 0.00
R8008:Alpi UTSW 1 87098662 missense unknown
X0052:Alpi UTSW 1 87100201 missense probably damaging 1.00
X0057:Alpi UTSW 1 87101078 missense probably damaging 1.00
Z1176:Alpi UTSW 1 87099072 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGACATGTCTACACTGTCCTGG -3'
(R):5'- AAGAAGCTGCAGCCCATTCAG -3'

Sequencing Primer
(F):5'- GTTGCAAACTTGGGCTCCAG -3'
(R):5'- AGCTAAGAACCTCATCATCTTCCTGG -3'
Posted On2018-06-22