Incidental Mutation 'R6508:Car4'
ID524013
Institutional Source Beutler Lab
Gene Symbol Car4
Ensembl Gene ENSMUSG00000000805
Gene Namecarbonic anhydrase 4
SynonymsCA IV
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84957786-84966044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84965643 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 252 (D252E)
Ref Sequence ENSEMBL: ENSMUSP00000099483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103194] [ENSMUST00000127827] [ENSMUST00000150596]
PDB Structure
MURINE CARBONIC ANHYDRASE IV [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE IV COMPLEXED WITH BRINZOLAMIDE [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103194
AA Change: D252E

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099483
Gene: ENSMUSG00000000805
AA Change: D252E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Carb_anhydrase 22 278 2.37e-103 SMART
low complexity region 283 299 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000108076
AA Change: D110E
SMART Domains Protein: ENSMUSP00000103711
Gene: ENSMUSG00000000805
AA Change: D110E

DomainStartEndE-ValueType
Carb_anhydrase 3 137 9.49e-7 SMART
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139416
Predicted Effect probably benign
Transcript: ENSMUST00000150596
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This gene encodes a glycosylphosphatidyl-inositol-anchored membrane isozyme expressed on the luminal surfaces of pulmonary (and certain other) capillaries and proximal renal tubules. Its exact function is not known; however, it may have a role in inherited renal abnormalities of bicarbonate transport. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are produced in lower than expected numbers, with females preferentially lost in the fetal or early postnatal period. Surviving homozygotes are healthy and fertile when crossed with wild-type partners; however, homozygous intercrosses yield small litters and pups do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Car4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Car4 APN 11 84965767 missense probably damaging 1.00
IGL01121:Car4 APN 11 84964346 critical splice acceptor site probably null
IGL01828:Car4 APN 11 84964745 missense probably benign 0.19
IGL02340:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02351:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02353:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02358:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02360:Car4 APN 11 84965767 missense probably damaging 1.00
PIT4802001:Car4 UTSW 11 84964405 missense probably damaging 1.00
R0008:Car4 UTSW 11 84963411 unclassified probably benign
R0501:Car4 UTSW 11 84963442 missense probably benign 0.01
R2124:Car4 UTSW 11 84964085 splice site probably benign
R3907:Car4 UTSW 11 84964357 missense probably damaging 1.00
R5072:Car4 UTSW 11 84963367 missense probably benign
R5268:Car4 UTSW 11 84965800 missense probably benign 0.28
R5562:Car4 UTSW 11 84964098 missense probably benign 0.05
R7775:Car4 UTSW 11 84965623 missense probably damaging 1.00
Z1177:Car4 UTSW 11 84963419 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGCTCAGCTTCCCACAAATG -3'
(R):5'- AGATAAGCCATGTCCTCTAAAGGC -3'

Sequencing Primer
(F):5'- AATGCCACACTTGACACTCTTGG -3'
(R):5'- CATGTCCTCTAAAGGCTGAGGTCAG -3'
Posted On2018-06-22