Incidental Mutation 'R6508:Ispd'
ID524017
Institutional Source Beutler Lab
Gene Symbol Ispd
Ensembl Gene ENSMUSG00000043153
Gene Nameisoprenoid synthase domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location36381450-36689503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36426299 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 180 (A180V)
Ref Sequence ENSEMBL: ENSMUSP00000152392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062041] [ENSMUST00000220519] [ENSMUST00000221177] [ENSMUST00000221452] [ENSMUST00000221895] [ENSMUST00000223068] [ENSMUST00000223205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062041
AA Change: A180V

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061646
Gene: ENSMUSG00000043153
AA Change: A180V

DomainStartEndE-ValueType
Pfam:IspD 45 277 2.5e-40 PFAM
Pfam:NTP_transf_3 47 274 3.1e-11 PFAM
low complexity region 359 370 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220519
AA Change: A180V

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221177
AA Change: A81V

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221452
AA Change: A180V

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221895
AA Change: A180V

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223068
AA Change: A81V

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000223205
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase-like protein. Mutations in this gene are the cause of Walker-Warburg syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit neonatal lethality due to respiratory failure, abnormal axon guidance and fasciculation, abnormal dorsal funiculus, detachment of radial glial cell endfeet and neuronal heterotopias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Ispd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Ispd APN 12 36473177 missense probably damaging 1.00
IGL01845:Ispd APN 12 36547919 missense probably benign 0.10
R0329:Ispd UTSW 12 36381838 missense possibly damaging 0.71
R0513:Ispd UTSW 12 36390468 missense probably damaging 1.00
R0798:Ispd UTSW 12 36521999 missense probably benign 0.26
R1676:Ispd UTSW 12 36476721 missense probably benign 0.02
R1704:Ispd UTSW 12 36521494 missense probably benign 0.00
R1937:Ispd UTSW 12 36390368 missense probably benign 0.13
R1987:Ispd UTSW 12 36521996 missense probably damaging 1.00
R4518:Ispd UTSW 12 36473180 missense possibly damaging 0.81
R5726:Ispd UTSW 12 36547830 missense probably damaging 0.99
R7315:Ispd UTSW 12 36390374 missense probably benign 0.00
R7395:Ispd UTSW 12 36501995 missense possibly damaging 0.86
R7819:Ispd UTSW 12 36381903 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTGGGTTGAGCAAACAC -3'
(R):5'- CCAGTGTTGGGGAAGGCC -3'

Sequencing Primer
(F):5'- ACTGTGGGTTGAGCAAACACTTTTG -3'
(R):5'- GGACTACATGCTGAGTCTCACAG -3'
Posted On2018-06-22