Incidental Mutation 'R6508:Pcnx'
ID524021
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81912705 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 170 (I170T)
Ref Sequence ENSEMBL: ENSMUSP00000152302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021567
AA Change: I170T

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: I170T

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221721
AA Change: I170T

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000222005
AA Change: I170T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- AGAATGTGCCCAACAGGTGTC -3'
(R):5'- CATATCCCCTATGCCAAAATGTTTC -3'

Sequencing Primer
(F):5'- GTGCCCAACAGGTGTCTTTAATATCG -3'
(R):5'- TAAGATCATGTTATGCC -3'
Posted On2018-06-22