Incidental Mutation 'R6508:Pcdh17'
ID524031
Institutional Source Beutler Lab
Gene Symbol Pcdh17
Ensembl Gene ENSMUSG00000035566
Gene Nameprotocadherin 17
SynonymsC030033F14Rik, LOC219228
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location84443563-84539002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84447979 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 629 (N629D)
Ref Sequence ENSEMBL: ENSMUSP00000071325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071370]
Predicted Effect probably damaging
Transcript: ENSMUST00000071370
AA Change: N629D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071325
Gene: ENSMUSG00000035566
AA Change: N629D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 54 131 6.8e-4 SMART
CA 155 242 8.81e-21 SMART
CA 266 350 8.27e-26 SMART
CA 375 468 9.14e-28 SMART
CA 492 579 8.4e-27 SMART
CA 608 687 2.53e-12 SMART
low complexity region 703 725 N/A INTRINSIC
low complexity region 751 759 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226362
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic transmission, increased synaptic vesicle number and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Pcdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pcdh17 APN 14 84447544 missense probably damaging 1.00
IGL00902:Pcdh17 APN 14 84446849 missense probably damaging 1.00
IGL01596:Pcdh17 APN 14 84448192 missense probably damaging 1.00
IGL01665:Pcdh17 APN 14 84447002 missense probably damaging 0.99
IGL01944:Pcdh17 APN 14 84447520 missense probably benign 0.01
IGL01944:Pcdh17 APN 14 84447521 missense probably damaging 0.98
IGL01977:Pcdh17 APN 14 84533097 missense possibly damaging 0.49
IGL01988:Pcdh17 APN 14 84446622 missense probably damaging 1.00
IGL02168:Pcdh17 APN 14 84533195 missense probably benign 0.19
IGL02500:Pcdh17 APN 14 84533469 missense probably benign 0.17
IGL02874:Pcdh17 APN 14 84448240 missense possibly damaging 0.71
IGL02882:Pcdh17 APN 14 84446661 missense probably damaging 0.98
IGL02941:Pcdh17 APN 14 84448307 missense probably damaging 1.00
IGL03328:Pcdh17 APN 14 84533111 missense probably benign
PIT4151001:Pcdh17 UTSW 14 84447358 missense probably benign 0.05
R0226:Pcdh17 UTSW 14 84448201 missense probably damaging 0.99
R0537:Pcdh17 UTSW 14 84447457 missense probably damaging 1.00
R0647:Pcdh17 UTSW 14 84447773 missense possibly damaging 0.58
R0939:Pcdh17 UTSW 14 84447755 missense probably damaging 1.00
R1014:Pcdh17 UTSW 14 84447488 missense probably damaging 1.00
R1753:Pcdh17 UTSW 14 84477654 missense probably benign 0.17
R3404:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3405:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3406:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3746:Pcdh17 UTSW 14 84533037 missense probably benign 0.02
R3852:Pcdh17 UTSW 14 84447259 nonsense probably null
R4015:Pcdh17 UTSW 14 84447107 missense probably damaging 0.99
R4348:Pcdh17 UTSW 14 84447620 missense probably damaging 0.97
R4365:Pcdh17 UTSW 14 84448286 missense probably damaging 0.97
R4375:Pcdh17 UTSW 14 84448271 missense possibly damaging 0.80
R4693:Pcdh17 UTSW 14 84533520 missense probably damaging 1.00
R4811:Pcdh17 UTSW 14 84447935 missense probably damaging 1.00
R5007:Pcdh17 UTSW 14 84533297 missense probably benign
R5074:Pcdh17 UTSW 14 84533342 missense probably benign
R5080:Pcdh17 UTSW 14 84533310 missense probably benign 0.01
R5138:Pcdh17 UTSW 14 84447209 missense probably damaging 1.00
R5330:Pcdh17 UTSW 14 84533046 missense probably damaging 1.00
R5541:Pcdh17 UTSW 14 84447416 missense probably damaging 0.97
R5686:Pcdh17 UTSW 14 84532993 missense probably damaging 1.00
R5692:Pcdh17 UTSW 14 84448540 missense probably benign 0.22
R5695:Pcdh17 UTSW 14 84446360 missense probably damaging 1.00
R5949:Pcdh17 UTSW 14 84447556 missense probably damaging 1.00
R6127:Pcdh17 UTSW 14 84533060 missense probably damaging 0.96
R6294:Pcdh17 UTSW 14 84477668 missense probably benign 0.01
R6726:Pcdh17 UTSW 14 84446217 missense probably damaging 1.00
R7094:Pcdh17 UTSW 14 84447395 missense probably damaging 1.00
R7137:Pcdh17 UTSW 14 84533549 missense possibly damaging 0.65
R7828:Pcdh17 UTSW 14 84532985 missense probably damaging 0.99
R7904:Pcdh17 UTSW 14 84448484 missense possibly damaging 0.94
R7987:Pcdh17 UTSW 14 84448484 missense possibly damaging 0.94
X0025:Pcdh17 UTSW 14 84446562 missense possibly damaging 0.86
X0026:Pcdh17 UTSW 14 84533097 missense possibly damaging 0.49
X0027:Pcdh17 UTSW 14 84448310 missense possibly damaging 0.80
Z1088:Pcdh17 UTSW 14 84448274 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TAGACGTGAACGACAACGC -3'
(R):5'- CTATGAGAGGCAGGGACATGTC -3'

Sequencing Primer
(F):5'- ACAACGCTCCAGTGATTGTG -3'
(R):5'- ACATGTCCCAGTGGTGCTG -3'
Posted On2018-06-22